Freiburg RNA Tools
GLASSgo - Help
BIF
IFF

Main Menu

Freiburg RNA Tools

Interaction Prediction

Seq-Str Alignment

CRISPR

Sequence Design

Splicing

SNP & Mutation

Classification

Gene set extension

MoDPepInt Server

CPSP-Tools Server

Galaxy-FR

CMV server

Teaching

Introduction

GLASSgo (GLobal Automated sRNA Search go) combines iterative BLAST searches, pairwise identity filtering, and structure based clustering in an automated prediction pipeline to find sRNA homologs from scratch. The web server provides predefined parameter sets for a non-expert usage as well as enables a manual setup of the query parameters. The returned GLASSgo result is in FASTA format, whereby the first entry represents the input sequence.

Published precomputed results for IsaR1 from PCC6803, IsaR1 from PCC6803 (adapted parameters), and IsaR1 from PCC7424 using GLASSgo v1.5.0.

When using GLASSgo please cite :

Results are computed with GLASSgo version 1.5.2

Overview

The following parameters are used to control the execution of GLASSgo

Furthermore, additional information is available

Sequence Parameters

?  Query sRNA in FASTA

The (single) sRNA sequence has to be provided in FASTA format. Input can be given either as direct text input or by uploading a file. A sequence in FASTA format begins with a single-line sequence identifier that starts with a greater-than (">") symbol, followed by lines of sequence data. For readability, it is recommended that each line is at most 80 characters in length.
The parameter constraints are: The input has to be in valid FASTA format. The number of sequences has to be at least 1 and at most 1. Sequence lengths have to be in the range 20-800. The allowed sequence alphabet is 'ACGUTacgut'.
Defaults to ()

Search Parameters

?  Taxon selection

The GLASSgo search is by default based on the complete NCBI ‘nt’ database. In general, sRNAs show a limited distribution among the phylogenetic tree, such that a targeted search in a specfic taxonomic group is likely to perform better. Thus, select the taxon that your search should be limited to.

?  Parameter setup

You can run GLASSgo either in automated mode or you can manually set the advanced parameters.

?  Maximum allowed E-value

The E-value mainly influences the sensitivity of GLASSgo. A relaxed E-value (>1.0) increases the chance to get more sequences, but also increases computation time.
The parameter constraints are: Input value has to be parsable as Double. The value must be smaller than or equal to 50.
Defaults to (1)

?  Minimum allowed identity [%]

Each sRNA candidate is compared to the query sRNA on sequence level and should have a percent identity larger than the value of this parameter to be kept for further analysis. Please note, that values lower than 65% increase the total number of hits, but also slightly increase the probability for false positives.
The parameter constraints are: Input value has to be parsable as Double. The value must be greater than or equal to 10 and must be smaller than or equal to 75.
Defaults to (52)

?  Structure-based clustering

Defines whether or not structural clustering (via Londen) is to be applied.
The parameter constraints are: Input value has to be parsable as Integer.
Defaults to ( on)

Structure-based clustering

?  Structure-based filtering

Structure-based filtering can either be done automatically or you can set manually an according structure-based filtering value (see according parameter).

?  Manual value for filtering

The structure-based filtering represents the third filtering step of GLASSgo and is applied to the candidate hits with medium percent identity (min_identity < %ID < 80%). Lowering the parameter value will result in a more strict analysis (less false positives) and vice versa.
The parameter constraints are: Input value has to be parsable as Double. The value must be greater than or equal to 0 and must be smaller than or equal to 3.
Defaults to (2)

Additional Settings

?  Include upstream region

Setting the parameter 'Upstream Region' to 100 extracts 100 nucleotides upstream for each predicted GLASSgo hit. This additionally sequence information is directly concatenated with the corresponding GLASSgo hit and therefore an integral part of the returned GLASSgo results. Note: The upstream region is not considered while the similarity value [%] is computed! In addition, the FASTA header (e.g. start position) for each GLASSgo hit will be updated (if upstream region is activated), whereas the upstream region is additionally mentioned like -UTR-REGION-100nt:1002422-1002521-. You can find further information about the GLASSgo results in the output help section.
(0 == no additional upstream region included).
The parameter constraints are: Input value has to be parsable as Integer. The value must be greater than or equal to 0 and must be smaller than or equal to 500.
Defaults to (0)

Output Description

The output of GLASSgo is a file in multi-FASTA format where the input sequence (query) is followed by the identified homologs. If no homologs could be found, only the input sequence is shown. In the following the output format will be discussed using two examples. Both examples show a partial result of GLASSgo applying EcpR1. In the first example,the upstream region was turned off while the value for the upstream region was set to 100 nt for the second. For this very reason, the headers as well as the sequence sizes are unequal.

The following header shows the Accession number of the respective genome followed by the genomic coordinates of the proposed sRNA homolog (no upstream region included). 

>CP013051.1:1422247-1422417 Sinorhizobium americanum CCGM7, complete genome-p.c.VAL:80.75%-taxID:1408224
AAAGGAAGTGAGACTTCCACGATCGATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCTTCCGACATCCGCGGATTCCTCGTGCCGCAGTCGGAGCCAGCCGACCCCCTTTCAAAACGCCGCTTCAAAAGAGGCGGCGTTT

In contrast, the next header shows the genomic coordinates of the combined upstream region (100nt) and the proposed sRNA. The exact coordinates of the upstream region are given later in the header (UPSTREAM-REGION-100nt:1422147-1422246). 
>CP013051.1:1422147-1422417 Sinorhizobium americanum CCGM7, complete genome-UPSTREAM-REGION-100nt:1422147-1422246-p.c.VAL:80.75%-taxID:1408224
ATTTGTCCGAATACGAGACAGAATTAACCAAACGCCGAGCAACCCGCTTCGGCGATTAAGAATTCGTTGATTTTTTTTTATTTTCAAGCAATGCTGATATAAAGGAAGTGAGACTTCCACGATCGATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCTTCCGACATCCGCGGATTCCTCGTGCCGCAGTCGGAGCCAGCCGACCCCCTTTCAAAACGCCGCTTCAAAAGAGGCGGCGTTT

Both examples contain the name of the genome entry and a pairwise similarity value of p.c.Val:80.75% (query vs. GLASSgo hit ) as well as their corresponding taxonomic number taxID:1408224.

Input Examples

?  EcpR1 in Proteobacteria

EcpR1 in Proteobacteria
The example's result can be directly accessed here

?  NsiR4 in Cyanobacteria

NsiR4 in Cyanobacteria
The example's result can be directly accessed here

List of Changes

About this web server  |  version 5.0.10  |  Copyright © 2012 - 2024 Bioinformatics Group Freiburg  |  de.NBI  |  Imprint and Disclaimer