Freiburg RNA Tools
GLASSgo - Results
BIF
IFF
GLASSgo 2153353

Input and runtime details for job 2153353 (precomputed example)

Sequence Parameters

? Query sRNA in FASTA[.fa]

Search Parameters

? Taxon selection Proteobacteria
? Parameter setup automatic
? Maximum allowed E-value1
? Minimum allowed identity [%]52
? Structure-based clustering on

Structure-based clustering

? Structure-based filteringauto
? Manual value for filtering2

Additional Settings

? Include upstream region0

Job ID 2153353 (server version trunk)

?Job Submitted & Queued@ Fri Nov 23 13:30:41 CET 2018
?Processing Started@ Fri Nov 23 13:32:38 CET 2018
?GLASSgo Finished & Post-Processing@ Fri Nov 23 15:01:40 CET 2018
?Post-Processing Finished@ Fri Nov 23 15:02:08 CET 2018
?Job Completed@ Fri Nov 23 15:02:11 CET 2018
 DIRECT ACCESS: http://rna.informatik.uni-freiburg.de:80/RetrieveResults.jsp?jobID=2153353&toolName=GLASSgo ( 30 days expiry )

The job description you specified

EcpR1 in Proteobacteria

? Output download complete results [zip]

In the following FASTA output, the input sequence is given top-most followed by the identified homologs.
If only the input sequence is shown, no homologs could be found.

>EcpR1_Sinorhizobium_meliloti_1021
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP013051.1:1422247-1422417 Sinorhizobium americanum CCGM7, complete genome-p.c.VAL:81.18%-taxID:1408224
AAAGGAAGTGAGACTTCCACGATCGATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCTTCCGACATCCGCGGATTCCTCGTGCCGCAGTCGGAGCCAGCCGACCCCCTTTCAAAACGCCGCTTCAAAAGAGGCGGCGTTT
>CP021800.1:c1112462-1112296 Sinorhizobium meliloti strain USDA1021, complete genome-p.c.VAL:100.0%-taxID:382
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP002740.1:974429-974595 Sinorhizobium meliloti BL225C, complete genome-p.c.VAL:100.0%-taxID:698936
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP001830.1:c2256278-2256112 Sinorhizobium meliloti SM11, complete genome-p.c.VAL:100.0%-taxID:707241
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP023063.1:1026656-1026827 Sinorhizobium sp. CCBAU 05631, complete genome-p.c.VAL:78.31%-taxID:794846
TAAGGAAGTGTGACTTCCACGATCGATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGTTTCCGACATCCGCGGATTCCTCGTGCCGCAGTCGGAGCCAGCCGACCCCCTTTCAAAACGCCGCTTCGGACTGAGGCGGCGTTT
>CP019485.1:1371131-1371297 Sinorhizobium meliloti strain B401 chromosome, complete genome-p.c.VAL:100.0%-taxID:382
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>FO082820.1:1291846-1292010 Rhizobium sp. NT-26 chromosome, complete genome-p.c.VAL:59.62%-taxID:1125847
TAGTTTGCGCGATTTTTAGAGACGAAAGATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGATCGATTGCATGTCTCGGTTCCTCGTGCCGTATTGCAGTCGGTCGACCCCCAAATAAAAAAGCACCGCTTTCAAGGAAAGCGGTG
>CP021793.1:1041172-1041338 Sinorhizobium meliloti strain USDA1157, complete genome-p.c.VAL:100.0%-taxID:382
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP023067.1:949343-949510 Ensifer sojae CCBAU 05684, complete genome-p.c.VAL:76.32%-taxID:716928
GGAAGTGCCACTTCCATTACCAATTCGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGTTTCCGGCGTCTGCGGATTCCTCGTGCCGCTGCTGGGACCAGCCGACCCCCTTTGAAAACGCCGCTTCGAAAGAAGTTGGCGTT
>CP003933.2:1383304-1383470 Sinorhizobium meliloti GR4, complete genome-p.c.VAL:100.0%-taxID:1235461
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP002781.1:1110062-1110228 Sinorhizobium meliloti AK83 chromosome 1, complete sequence-p.c.VAL:100.0%-taxID:693982
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP016450.1:c1578678-1578511 Sinorhizobium sp. RAC02, complete genome-p.c.VAL:67.84%-taxID:1842534
TGGGCGGCAAACAAGCCCGCACAACCGGTTACCCCATGATGCTAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGTCAGCTGCGACAAATACGGAATCCTCGTGCCGTCGTCGTGTCTGACCGACCCCCATTCAGCGCCGCTCCCGTCAAGGGGGCGGCGTTT
>CP015736.1:1489276-1489441 Shinella sp. HZN7, complete genome-p.c.VAL:66.67%-taxID:879274
TGGGCGGCAAACAAGCCCGCACAACCGGTTACCCCATGATGCTAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGTCAGCTACGACAAATACGGAATCCTCGTGCCGTCGTCGTGTCTGGCCGACCCCCGTTCAACGCCGCTCCCTTCTAGGGAGCGGCGT
>CP021219.1:c3686829-3686663 Sinorhizobium meliloti RU11/001, complete genome-p.c.VAL:100.0%-taxID:1401243
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>HE995405.1:1053842-1054008 Sinorhizobium meliloti Rm41 complete genome-p.c.VAL:100.0%-taxID:1230587
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP013107.1:1435188-1435358 Sinorhizobium americanum strain CFNEI 73, complete genome-p.c.VAL:80.21%-taxID:194963
AAAGGAAGTGAGACTTCCACGATCGATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCTTCCGACATCCGCGGATTCCTCGTGCCGCAGTCGGAGCCAGCCGACCCCCTTTCAAAACGCCGCCTCAAAAGAGGCGGCGTTT
>HE616890.1:1104750-1104920 Sinorhizobium fredii HH103 main chromosome, complete sequence-p.c.VAL:80.21%-taxID:1117943
AAAGGAAGTGAGACTTCCACGATCGATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGATTCCGACATCCGCGGATTCCTCGTGCCGCAGTCGGAGCCAGCCGACCCCCTTTCGGAACGCCGCTTCGAAGGAGGCGGCGTTT
>CP007236.1:2283540-2283709 Ensifer adhaerens OV14 chromosome 1 sequence-p.c.VAL:74.09%-taxID:1416753
GCGGGGGCATAGCTTCCATCAGCTTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGTTGGCTTTTGACACCTGCGGAATCCTCGTGCCGCGGTCAGTAGCCAGCCGACCCCCATTCAAAGCGCTGTTCCGGAAGGGACAGCGCTT
>CP019488.1:1395987-1396153 Sinorhizobium meliloti strain B399 chromosome, complete genome-p.c.VAL:100.0%-taxID:382
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP019488.1:1692035-1692201 Sinorhizobium meliloti strain B399 chromosome, complete genome-p.c.VAL:100.0%-taxID:382
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>AL591688.1:1411678-1411844 Sinorhizobium meliloti 1021 complete chromosome-p.c.VAL:100.0%-taxID:266834
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP021812.1:c1658544-1658378 Sinorhizobium meliloti strain M270, complete genome-p.c.VAL:100.0%-taxID:382
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP021808.1:193836-194002 Sinorhizobium meliloti strain Rm41, complete genome-p.c.VAL:100.0%-taxID:382
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP000738.1:1002522-1002690 Sinorhizobium medicae WSM419, complete genome-p.c.VAL:95.35%-taxID:366394
GCGAGGAAGGAAACTTCCACAGCAATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGATTTGCGGATTCCTCGTGCTGCAACCGGAACCAGCCGACCCCCATTCGAAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP021797.1:c248727-248561 Sinorhizobium meliloti strain USDA1106, complete genome-p.c.VAL:100.0%-taxID:382
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP009144.1:1399641-1399807 Sinorhizobium meliloti strain RMO17, complete genome-p.c.VAL:100.0%-taxID:382
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP003563.1:3505461-3505631 Sinorhizobium fredii USDA 257, complete genome-p.c.VAL:80.65%-taxID:1185652
TAAGGAAGTGTGACTTCCACGATCGATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGTTTCTGACATCCGCGGATTCCTCGTGCCGCAGTCGGAGCCAGCCGACCCCCTTTCAAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP019584.1:1378388-1378554 Sinorhizobium meliloti strain CCMM B554 (FSM-MA), complete genome-p.c.VAL:100.0%-taxID:382
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP023070.1:1006893-1007063 Sinorhizobium fredii CCBAU 83666, complete genome-p.c.VAL:80.21%-taxID:1128334
AAAGGAAGTGAGACTTCCACGATCGATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGATTCCGACATCCGCGGATTCCTCGTGCCGCAGTCGGAGCCAGCCGACCCCCTTTCGGAACGCCGCTTCGAAGGAGGCGGCGTTT
>CP021804.1:c748856-748690 Sinorhizobium meliloti strain T073, complete genome-p.c.VAL:100.0%-taxID:382
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP021822.1:2033440-2033606 Sinorhizobium meliloti strain KH46, complete genome-p.c.VAL:100.0%-taxID:382
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP021825.1:c2174850-2174684 Sinorhizobium meliloti strain KH35c, complete genome-p.c.VAL:98.81%-taxID:382
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGATTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP001389.1:1145485-1145656 Sinorhizobium fredii NGR234, complete genome-p.c.VAL:78.31%-taxID:394
TAAGGAAGTGTGACTTCCACGATCGATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGATTCCGACGTCCGCGGATTCCTCGTGCCGCAGTCGGAGCCCAGCCGACCCCCTTTCGGAACGCCGCTCCGAAGGAGGCGGCGTTT
>CP021818.1:1507687-1507853 Sinorhizobium meliloti strain M162, complete genome-p.c.VAL:100.0%-taxID:382
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP015880.1:1096106-1096274 Ensifer adhaerens strain Casida A, complete genome-p.c.VAL:68.34%-taxID:106592
GGGGCATCCAGCCTTCTGCGATATTCGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGTTGGCTTTTGGCGTCCGCGGAATCCTCGTGCCGCAGTCAGAGGCCAGCCGACCCCCTTTCCGACACGCCGTCCCGCCTTCGGGGCGGCG
>CP021829.1:1882550-1882716 Sinorhizobium meliloti strain HM006, complete genome-p.c.VAL:100.0%-taxID:382
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>CP004140.1:1411680-1411846 Sinorhizobium meliloti 2011, complete genome-p.c.VAL:100.0%-taxID:1286640
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT

Taxonomic tree

The taxonomic tree illustrates the outcome of the GLASSgo result.
You can Each taxonomic name has a specific value, which describes the number of summarized GLASSgo hits. These values are also used for scaling the corresponding nodes.

Job resubmission

Use the following button if you want to resubmit the job with altered input or parameterization:
Feeds the job parameters to the input page to resubmit the job.

de.NBI usability assessment

Please support us by filling this short quality survey for evaluating this de.NBI service.

When using GLASSgo please cite :

Results are computed with GLASSgo version 1.5.2