Freiburg RNA Tools
GLASSgo - Results
BIF
IFF
GLASSgo 4045125

Input and runtime details for job 4045125 (precomputed example)

Sequence Parameters

? Query sRNA in FASTA[.fa]

Search Parameters

? Taxon selection Cyanobacteria
? Parameter setup automatic
? Maximum allowed E-value1
? Minimum allowed identity [%]52
? Structure-based clustering on

Structure-based clustering

? Structure-based filteringauto
? Manual value for filtering2

Additional Settings

? Include upstream region0

Job ID 4045125 (server version trunk)

?Job Submitted & Queued@ Fri Nov 23 13:33:32 CET 2018
?Processing Started@ Fri Nov 23 13:35:34 CET 2018
?GLASSgo Finished & Post-Processing@ Fri Nov 23 14:47:57 CET 2018
?Post-Processing Finished@ Fri Nov 23 14:48:28 CET 2018
?Job Completed@ Fri Nov 23 14:48:31 CET 2018
 DIRECT ACCESS: http://rna.informatik.uni-freiburg.de:80/RetrieveResults.jsp?jobID=4045125&toolName=GLASSgo ( 30 days expiry )

The job description you specified

NsiR4 in Cyanobacteria

? Output download complete results [zip]

In the following FASTA output, the input sequence is given top-most followed by the identified homologs.
If only the input sequence is shown, no homologs could be found.

>NsiR4_Synechocystis_sp_PCC6803
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCATTGCTTCAGTGGCGGCTTTCTTTTT
>CP003646.1:c1954909-1954836 Gloeocapsa sp. PCC 7428, complete genome-p.c.VAL:60.0%-taxID:1173026
TTTAGATTAAGCTGTTAACACCCTCCGATTGCTCAAGCAACCGCCATCAAGCTAGCTAGTGGCGGTTTTTTGTT
>CP012375.1:c508130-508062 Microcystis aeruginosa NIES-2481, complete genome-p.c.VAL:61.63%-taxID:1698524
AAGACATAAAGTCAATATCACCCTCCGATTGCAATGAGAAAATGTTTGGATCGCTTAATATTTAAGCCC
>AP012549.1:5724-5792 Cyanobacterium endosymbiont of Epithemia turgida isolate EtSB Lake Yunoko DNA, complete genome-p.c.VAL:64.29%-taxID:1228987
AATACATAAAGTCAATTATTAGCCTTCGATTGCTTAGGATGACTACTCACTCTTTAGTGGTATTTTTTC
>CP001291.1:c4248692-4248623 Cyanothece sp. PCC 7424, complete genome-p.c.VAL:78.21%-taxID:65393
AAGACATAAAGTCAATATCACCCTCCGATTGCTTATCCAGGCCGCCCATAGTCTAGGGGCGGTTTCTCTT
>AP018341.1:c1668349-1668282 Cyanobacterium endosymbiont of Rhopalodia gibberula DNA, complete genome, isolate: RgSB-p.c.VAL:60.47%-taxID:1763363
AAAGATAAAATCAATTATTAGTCTCCGATTGCTTAGGATGACTGTCCGTCCTTTAGTATCGTTTTTTT
>CP016474.1:2244707-2244779 Synechococcus sp. PCC 7003, complete genome-p.c.VAL:57.78%-taxID:374981
CCCGCGCTAGGTTAGCAATACCCTCCGATTGCTTATCAAGCTAGACCGTCCCCCCCAGTGGCGGTTTTTTATT
>CP003552.1:c5825588-5825525 Nostoc sp. PCC 7524, complete genome-p.c.VAL:57.65%-taxID:28072
AAGAGTAGTCTAGAAATTACCCTCCGATTGCTTAAACAAACCGCCCTATAGTGGCGGTTTTCTC
>CP013998.1:2202505-2202578 Synechococcus sp. PCC 73109, complete genome-p.c.VAL:57.14%-taxID:374982
CCCGCGCTAGGTTAGCAATACCCTCCGATTGCTTATCAAGCTAGACCGTCCTCACCCAGTGGCGGTTTTTTATT
>CP007542.1:c257489-257420 Synechocystis sp. PCC 6714, complete genome-p.c.VAL:98.57%-taxID:1147
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCGTTGCTTCAGTGGCGGCTTTCTTTTT
>BA000022.2:c1289326-1289257 Synechocystis sp. PCC 6803 DNA, complete genome-p.c.VAL:100.0%-taxID:1148
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCATTGCTTCAGTGGCGGCTTTCTTTTT
>CP011941.1:2424843-2424911 Synechococcus sp. WH 8020 genome-p.c.VAL:52.75%-taxID:32052
GGAGACGCTGTTCCCACCCTGATTTTGTTGCTGGTGGTGAGCCCATTGCTTCAGTGGCTTCCGCTGCTG
>AM778881.1:2250-2318 Microcystis aeruginosa PCC 7806 genome sequencing data, contig C251-p.c.VAL:65.06%-taxID:267872
AAGACATAAAGTCAATATCACCCTCCGATTGCAATGAGAAAATGTTTGAATCGCTTAATATTTGGGCTT
>CP003590.1:4604043-4604111 Pleurocapsa sp. PCC 7327, complete genome-p.c.VAL:56.18%-taxID:118163
AAGATATAGAGTCAATATCACCCTCCGATTGCTGGAAATTGACCTCCTTAATCTGTCGCAATGTAAAGA
>AM778951.1:90327-90395 Microcystis aeruginosa PCC 7806 genome sequencing data, contig C321-p.c.VAL:65.06%-taxID:267872
AAGACATAAAGTCAATATCACCCTCCGATTGCAATGAGAAAATGTTTGAATCGCTTAATATTTGGGCTT
>CP020771.1:c600281-600213 Microcystis aeruginosa PCC 7806SL, complete genome-p.c.VAL:65.06%-taxID:1903187
AAGACATAAAGTCAATATCACCCTCCGATTGCAATGAGAAAATGTTTGAATCGCTTAATATTTGGGCTT
>CP002198.1:c2006173-2006101 Cyanothece sp. PCC 7822, complete genome-p.c.VAL:77.5%-taxID:497965
AAGACATAAAGTCAATATCACCCTCCGATTGCTTATCCAAGCCGCCCGTTGTCTAGGGGCGGTTTCTCTTTTT
>AP012495.1:c2672591-2672522 Bacillus subtilis BEST7613 DNA, complete genome-p.c.VAL:100.0%-taxID:1204343
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCATTGCTTCAGTGGCGGCTTTCTTTTT
>AP009552.1:4321642-4321710 Microcystis aeruginosa NIES-843 DNA, complete genome-p.c.VAL:61.63%-taxID:449447
AAGACATAAAGTCAATATCACCCTCCGATTGCAATGAAAAAATGTTTGGATCGCTTAAGGTTTAAGCCT
>AF381044.1:400-473 Synechococcus sp. PCC 7002 type II NADH dehydrogenase B (ndbB) gene, complete cds-p.c.VAL:57.14%-taxID:32049
CCCGCGCTAGGTTAGCAATACCCTCCGATTGCTTATCAAGCTAGACCGTCCTCACCCAGTGGCGGTTTTTTATT
>CP012832.1:c1288399-1288330 Synechocystis sp. PCC 6803 substrain GT-G, complete genome-p.c.VAL:100.0%-taxID:1148
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCATTGCTTCAGTGGCGGCTTTCTTTTT
>CP002059.1:2779593-2779658 'Nostoc azollae' 0708, complete genome-p.c.VAL:63.41%-taxID:551115
AATTAAGTAAGGTGTAATTACCCTCCGATTGCTTAAGCATACCGCCCCCACTAGAGGCGGTTTTTT
>CP003597.1:c1592411-1592347 Chroococcidiopsis thermalis PCC 7203, complete genome-p.c.VAL:58.82%-taxID:251229
AATCGGTAAGCTGTTGAAAACCCTCCGATTGCTCAACAACCGCCATCTCCTGGCGGTTTTTTATT
>CP003620.1:3331800-3331870 Crinalium epipsammum PCC 9333, complete genome-p.c.VAL:68.67%-taxID:1173022
AGCAACGTAAGGTATTGATACCCTCCGATTGCTTAAGACGACCGCCCTCTTTCTAGTGGCGGTTTTTTATT
>AP012278.1:c1288398-1288329 Synechocystis sp. PCC 6803 substr. PCC-P DNA, complete genome-p.c.VAL:100.0%-taxID:1080230
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCATTGCTTCAGTGGCGGCTTTCTTTTT
>CP000806.1:666566-666637 Cyanothece sp. ATCC 51142 circular chromosome, complete sequence-p.c.VAL:77.5%-taxID:43989
AAGACATAAAGTCAATTATCACCCTCCGATTGCTTATTGCAACCGCCCACACTTCAGTGGCGGTTTTTTATT
>AP012205.1:c1288143-1288074 Synechocystis sp. PCC 6803 DNA, complete genome, strain: GT-S-p.c.VAL:100.0%-taxID:1148
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCATTGCTTCAGTGGCGGCTTTCTTTTT
>AP012276.1:c1288245-1288176 Synechocystis sp. PCC 6803 substr. GT-I DNA, complete genome-p.c.VAL:100.0%-taxID:1080228
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCATTGCTTCAGTGGCGGCTTTCTTTTT
>CP003265.1:c1287796-1287727 Synechocystis sp. PCC 6803, complete genome-p.c.VAL:100.0%-taxID:1148
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCATTGCTTCAGTGGCGGCTTTCTTTTT
>CP011304.1:c510694-510626 Microcystis aeruginosa NIES-2549, complete genome-p.c.VAL:61.63%-taxID:1641812
AAGACATAAAGTCAATATCACCCTCCGATTGCAATGAGAAAATGTTTGGATCGCTTAATATTTAAGCCC
>CP000951.1:2203752-2203825 Synechococcus sp. PCC 7002, complete genome-p.c.VAL:57.14%-taxID:32049
CCCGCGCTAGGTTAGCAATACCCTCCGATTGCTTATCAAGCTAGACCGTCCTCACCCAGTGGCGGTTTTTTATT
>CP017599.1:7196019-7196086 Moorea producens PAL-8-15-08-1, complete genome-p.c.VAL:61.9%-taxID:1458985
ATCAAGTAACCTAGAGTTACCCTCCGATTGCTTAACCATCCCGCCCTATTGCTAGCGGCGGTTTTTTA
>CP017708.1:6970845-6970912 Moorea producens JHB sequence-p.c.VAL:61.18%-taxID:1454205
ACCAAGTAACCTAGAGTTACCCTCCGATTGCTTAACCATGCCGCCCTATTGCTAGCGGCGGTTTTTTA
>AP018269.1:749499-749565 Cylindrospermum sp. NIES-4074 DNA, nearly complete genome-p.c.VAL:61.9%-taxID:2005457
AGCATAGTAAGCTAAAACTACCCTCCGATTACTTAACCACACCGCCCTCATTTAGTGGCGGTTTTTT
>CP011339.1:2880774-2880842 Microcystis panniformis FACHB-1757, complete genome-p.c.VAL:64.29%-taxID:1638788
AAGACATAAAGTCAATATCACCCTCCGATTGCAATGAAAAAATGTTTGGATCGCTTAGTATTTAAGCCT
>CP016483.1:2220526-2220599 Synechococcus sp. PCC 8807, complete genome-p.c.VAL:57.14%-taxID:195248
CCCGCGCTAGGTTAGCAATACCCTCCGATTGCTTATCAAGCTAGACCGTCCTCACCCAGTGGCGGTTTTTTATT
>AP018254.1:c1095032-1094965 Calothrix sp. NIES-3974 DNA, complete genome-p.c.VAL:58.62%-taxID:2005462
ACGGATTAGTCTGTAAATACCCTCCGATTGCTTAACCAAACCGACCTCCAGAGTGAGGCGGTTTTTTT
>CP016477.1:2215408-2215481 Synechococcus sp. PCC 7117, complete genome-p.c.VAL:57.14%-taxID:195498
CCCGCGCTAGGTTAGCAATACCCTCCGATTGCTTATCAAGCTAGACCGTCCTCACCCAGTGGCGGTTTTTTATT
>AP012277.1:c1288386-1288317 Synechocystis sp. PCC 6803 substr. PCC-N DNA, complete genome-p.c.VAL:100.0%-taxID:1080229
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCATTGCTTCAGTGGCGGCTTTCTTTTT

Taxonomic tree

The taxonomic tree illustrates the outcome of the GLASSgo result.
You can Each taxonomic name has a specific value, which describes the number of summarized GLASSgo hits. These values are also used for scaling the corresponding nodes.

Job resubmission

Use the following button if you want to resubmit the job with altered input or parameterization:
Feeds the job parameters to the input page to resubmit the job.

de.NBI usability assessment

Please support us by filling this short quality survey for evaluating this de.NBI service.

When using GLASSgo please cite :

Results are computed with GLASSgo version 1.5.2