Input and runtime details for job 7154744 (precomputed example)

Constraints

	RNA Secondary Structure		(((((...(((((......))))).)))))
	Sequence Constraints and Allowed Violations		6 U + 7 G + 8 C - 14 C - 15 A - 16 G - 17 U - 18 G - 19 H + 25 C -
	Maximal number of violations		999

Parameters for the Stochastic Local Search

	Objective function		mfe (default)
	Probability for accepting bad mutations		0.1
	Pre-sort candidates for mutation		yes (default)

Result Parameters

Number of Designed Sequences

Job ID 7154744 (server version 4.0.0)

	Job Submitted & Queued		@ Thu Jun 18 18:36:30 CEST 2015
	INFORNA Started		@ Thu Jun 18 18:36:37 CEST 2015
	INFORNA Finished & Post-Processing		@ Thu Jun 18 18:36:38 CEST 2015
	Job Completed		@ Thu Jun 18 18:36:39 CEST 2015

DIRECT ACCESS: http://rna.informatik.uni-freiburg.de/RetrieveResults.jsp?jobID=7154744&toolName=INFORNA ( 30 days expiry )

Description of the job

Hairpin loop design

Design of a long hairpin loop with soft and hard sequence constraints

Output

Result files for download

download full results [zip]

INFO-RNA Results

Input:

General Parameters:

RNA secondary structure:

5'-(((((...(((((......))))).)))))-3'

Sequence constraints:

5'-NNNNNUGCNNNNNCAGUGHNNNNNCNNNNN-3'

Allowed constraint violations:

5'-000001100000000000100000000000-3'

Maximal number of violations:

999


	Parameters for the Stochastic Local Search:
	Objective function:	mfe
	Probability for accepting bad mutations:	0.1
	Pre-sort candidates for mutation:	yes

Results:

1. Designed Sequence:

Designed sequence:

5'-GGGCCUACGCCCCCAGUGAGGGGCCGGCCC-3'

Target structure:

5'-(((((...(((((......))))).)))))-3'

Constraint violations:

Free energy (target structure):

-19.50 kcal/mol

Folding probability (target structure):

0.851084

Base pair distance of the mfe structure
to the target structure:

mfe structure: (.svg figure)

5'-(((((...(((((......))))).)))))-3'

Direct output for copy and paste:

designed sequence →
target structure →
mfe structure →

GGGCCUACGCCCCCAGUGAGGGGCCGGCCC
(((((...(((((......))))).)))))
(((((...(((((......))))).)))))

Downloadable File Formats (designed sequence + its mfe structure):

.fasta file
.ct file
.RNAML file

.svg, .pdf, or .ps figure of the mfe structure

Job resubmission

Use the following button if you want to resubmit the job with altered input or parameterization:

usability assessment

Please support us by filling this short quality survey for evaluating this

service.

When using INFORNA please cite :

Anke Busch and Rolf Backofen
INFO-RNA - A Server for Fast Inverse RNA Folding Satisfying Sequence Constraints
Nucleic Acid Research, 35 (Web Server Issue) W310-3, 2007
Anke Busch and Rolf Backofen
INFO-RNA - a fast approach to inverse RNA folding
Bioinformatics, 22 no. 15 pp. 1823-31, 2006
Martin Raden, Syed M Ali, Omer S Alkhnbashi, Anke Busch, Fabrizio Costa, Jason A Davis, Florian Eggenhofer, Rick Gelhausen, Jens Georg, Steffen Heyne, Michael Hiller, Kousik Kundu, Robert Kleinkauf, Steffen C Lott, Mostafa M Mohamed, Alexander Mattheis, Milad Miladi, Andreas S Richter, Sebastian Will, Joachim Wolff, Patrick R Wright, and Rolf Backofen
Freiburg RNA tools: a central online resource for RNA-focused research and teaching
Nucleic Acids Research, 46(W1), W25-W29, 2018.

Results are computed with INFORNA version 2.2.0 linking Vienna RNA package 1.8.4

Main Menu

Freiburg RNA Tools

Interaction Prediction

Seq-Str Alignment

CRISPR

Sequence Design

Splicing

SNP & Mutation

Classification

Gene set extension

MoDPepInt Server

CPSP-Tools Server

Galaxy-FR

CMV server

Teaching