Freiburg RNA Tools
CRISPRmap
BIF
IFF
CRISPRmap 8888684
Select Structure Motif
Select Sequence Family

? CRISPRmap tree of consensus CRISPR sequences

The CRISPRmap
The CRISPRmap
Zoom: View:
Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families The CRISPRmap - legend
CRISPRmap download: [.jpg] [.pdf] [.svg]

? Class assignments -- orientation predicted

IDInputStructuresSequencesSuperclass
1UserId=Paeruginos CRISPRmap=Paer_E_G_1_M4_F5
GTTCACTGCCGTACAGGCAGCTAAGAAA
motif 4 family 5 C
2UserId=Ecoli_K12 CRISPRmap=Efer_A_G_2_M2_F4
GAGUUCCCCGCGCCAGCGGGGAUAAACCG
motif 2 family 4 C
3UserId=Stepidermi
GAUCGAUACCCACCCCGAAGAAAAGGGGACGAGAAC
motif 28 - E
4UserId=TthermophH CRISPRmap=Mhyd3_A_G_3_M2_F4
GUAGUCCCCACGCACGUGGGGAUGGACCG
motif 2 family 4 C
5UserId=TthermophH CRISPRmap=Tthe_0JL_P_2_M2_F4
GUAGUCCCCACGCGUGUGGGGAUGGACCG
motif 2 family 4 C
6UserId=Spyogenes CRISPRmap=Spyo_0MG_G_1_X_F35
GUUUUAGAGCUAUGCUGUUUUGAAUGGUCCCAAAAC
- family 35 E
7UserId=Pfuriosus_ CRISPRmap=Pfur_A_G_4_X_F10
GUUACAAUAAGACCAAAAUAGAAUUGAAAG
- family 10 A
8UserId=Pfuriosus_ CRISPRmap=Pfur_A_G_9_X_F10
GUUACAAUAAGACUAAAAUAGAAUUGAAAG
- family 10 A
9UserId=MmarzeiGo1 CRISPRmap=Mmaz_A_G_4_M13_F26
AUUCGUGAGCAAGAUCCACUAAAACAAGGAUUGAAAC
motif 13 family 26 E
10UserId=MmarzeiGo1 CRISPRmap=Mmaz_A_G_5_M13_F26
AUUCGCGAGCAAGAUCCAUUAAAACAAGGAUUGAAAC
motif 13 family 26 E
11UserId=Mmaripalud CRISPRmap=Mmar_0X1_G_1_M29_X
CUAAAAGAAUAACUUGCAAAAUAACAAGCAUUGAAAC
motif 29 - E
12UserId=Synecho680 CRISPRmap=SYNE4_P_1_M5_X
CUUUCCUUCUACUAAUCCCGGCGAUCGGGACUGAAAC
motif 5 - E
13UserId=Synecho680
GTTTCAGTTCCCCTGACGGGGAAAAGAGGGTGTTGAAG
- - D
14UserId=Synecho680 CRISPRmap=SYNE4_P_3_M14_X
GUCUCCACUCGUAGGAGAAAUUAAUUGAUUGGAAAC
motif 14 - E
15UserId=Bhaloduran CRISPRmap=Bhal1_A_G_4_M3_F3
GUCGCACUCUUCAUGGGUGCGUGGAUUGAAAU
motif 3 family 3 D
16UserId=TthermophH CRISPRmap=Tthe2_C_P_6_M9_F37
GUUGCACCGGCCCGAAAGGGCCGGUGAGGAUUGAAAC
motif 9 family 37 D

? Close up on structure motifs

Details on motif 1:
Crispr repeats265
Genomes159
Bacteria156
Archaea2
SuperclassB
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 1
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 1
 
RNAz alignment statistics:
Mean pairwise identity76.64
Shannon entropy0.57
Mean single sequence MFE-13.44
Consensus MFE-9.71
Energy contribution-9.23
Covariance contribution-0.48
Mean z-score-2.27
Structure conservation index0.72
SVM RNA-class probability1
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 1
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 1
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 2:
Crispr repeats222
Genomes132
Bacteria128
Archaea4
SuperclassC
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 2
Original: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
New: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.svg]


Comments:
  • Your sequence(s) contain structure motif 2!
  • They are part of the CRISPRmap database.
 
RNAz alignment statistics:
Mean pairwise identity63.12
Shannon entropy0.9
Mean single sequence MFE-13.6
Consensus MFE-12.44
Energy contribution-11.53
Covariance contribution-0.91
Mean z-score-2.44
Structure conservation index0.91
SVM RNA-class probability1
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

Your sequences are highlighted in red!

 
Alignment:
Alignment of structure motif no. 2
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 2
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 3:
Crispr repeats195
Genomes131
Bacteria130
Archaea1
SuperclassD
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 3
Original: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
New: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.svg]


Comments:
  • Your sequence(s) contain structure motif 3!
  • They are part of the CRISPRmap database.
 
RNAz alignment statistics:
Mean pairwise identity76.61
Shannon entropy0.57
Mean single sequence MFE-13.26
Consensus MFE-14.21
Energy contribution-12.55
Covariance contribution-1.66
Mean z-score-2.37
Structure conservation index1.07
SVM RNA-class probability0.99
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

Your sequences are highlighted in red!

 
Alignment:
Alignment of structure motif no. 3
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 3
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 4:
Crispr repeats142
Genomes97
Bacteria97
Archaea0
SuperclassC
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 4
Original: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
New: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.svg]


Comments:
  • Your sequence(s) contain structure motif 4!
  • They are part of the CRISPRmap database.
 
RNAz alignment statistics:
Mean pairwise identity85.12
Shannon entropy0.41
Mean single sequence MFE-8.59
Consensus MFE-8.72
Energy contribution-8.23
Covariance contribution-0.48
Mean z-score-1.97
Structure conservation index1.01
SVM RNA-class probability0.99
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

Your sequences are highlighted in red!

 
Alignment:
Alignment of structure motif no. 4
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 4
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 5:
Crispr repeats106
Genomes60
Bacteria60
Archaea0
SuperclassE
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 5
Original: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
New: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.svg]


Comments:
  • Your sequence(s) contain structure motif 5!
  • They are part of the CRISPRmap database.
 
RNAz alignment statistics:
Mean pairwise identity59.29
Shannon entropy0.98
Mean single sequence MFE-11.92
Consensus MFE-7.46
Energy contribution-6.77
Covariance contribution-0.69
Mean z-score-1.98
Structure conservation index0.63
SVM RNA-class probability1
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

Your sequences are highlighted in red!

 
Alignment:
Alignment of structure motif no. 5
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 5
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 6:
Crispr repeats89
Genomes67
Bacteria67
Archaea0
SuperclassB
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 6
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 6
 
RNAz alignment statistics:
Mean pairwise identity88.93
Shannon entropy0.29
Mean single sequence MFE-9.77
Consensus MFE-10
Energy contribution-9.6
Covariance contribution-0.4
Mean z-score-2.43
Structure conservation index1.02
SVM RNA-class probability1
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 6
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 6
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 7:
Crispr repeats78
Genomes25
Bacteria22
Archaea3
SuperclassA
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 7
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 7
 
RNAz alignment statistics:
Mean pairwise identity80.62
Shannon entropy0.49
Mean single sequence MFE-0.36
Consensus MFE0
Energy contribution0
Covariance contribution0
Mean z-score0.62
Structure conservation index0
SVM RNA-class probability0
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 7
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 7
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 8:
Crispr repeats55
Genomes26
Bacteria26
Archaea0
SuperclassA
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 8
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 8
 
RNAz alignment statistics:
Mean pairwise identity83.05
Shannon entropy0.4
Mean single sequence MFE-2.27
Consensus MFE-0.58
Energy contribution-0.15
Covariance contribution-0.43
Mean z-score0
Structure conservation index0.25
SVM RNA-class probability0
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 8
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 8
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 9:
Crispr repeats52
Genomes31
Bacteria31
Archaea0
SuperclassD
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 9
Original: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
New: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.svg]


Comments:
  • Your sequence(s) contain structure motif 9!
  • They are part of the CRISPRmap database.
 
RNAz alignment statistics:
Mean pairwise identity55.6
Shannon entropy1.07
Mean single sequence MFE-19.44
Consensus MFE-22.33
Energy contribution-18.75
Covariance contribution-3.58
Mean z-score-3.96
Structure conservation index1.15
SVM RNA-class probability0.91
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

Your sequences are highlighted in red!

 
Alignment:
Alignment of structure motif no. 9
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 9
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 10:
Crispr repeats50
Genomes12
Bacteria10
Archaea2
SuperclassA
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 10
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 10
 
RNAz alignment statistics:
Mean pairwise identity90.44
Shannon entropy0.26
Mean single sequence MFE-5.85
Consensus MFE-4.81
Energy contribution-4.58
Covariance contribution-0.23
Mean z-score-0.38
Structure conservation index0.82
SVM RNA-class probability0.05
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 10
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 10
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 11:
Crispr repeats45
Genomes21
Bacteria0
Archaea21
SuperclassF
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 11
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 11
 
RNAz alignment statistics:
Mean pairwise identity73.13
Shannon entropy0.6
Mean single sequence MFE-2.6
Consensus MFE-3.4
Energy contribution-2.36
Covariance contribution-1.04
Mean z-score-0.22
Structure conservation index1.31
SVM RNA-class probability0.65
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 11
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 11
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 12:
Crispr repeats40
Genomes18
Bacteria15
Archaea3
SuperclassE
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 12
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 12
 
RNAz alignment statistics:
Mean pairwise identity67.87
Shannon entropy0.77
Mean single sequence MFE-6.97
Consensus MFE-3.7
Energy contribution-3.32
Covariance contribution-0.38
Mean z-score-1.58
Structure conservation index0.53
SVM RNA-class probability1
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 12
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 12
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 13:
Crispr repeats37
Genomes20
Bacteria5
Archaea15
SuperclassE
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 13
Original: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
New: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.svg]


Comments:
  • Your sequence(s) contain structure motif 13!
  • They are part of the CRISPRmap database.
 
RNAz alignment statistics:
Mean pairwise identity75.08
Shannon entropy0.61
Mean single sequence MFE-4.5
Consensus MFE-3.44
Energy contribution-3.14
Covariance contribution-0.3
Mean z-score-0.74
Structure conservation index0.76
SVM RNA-class probability0.94
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

Your sequences are highlighted in red!

 
Alignment:
Alignment of structure motif no. 13
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 13
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 14:
Crispr repeats35
Genomes24
Bacteria24
Archaea0
SuperclassE
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 14
Original: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
New: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.svg]


Comments:
  • Your sequence(s) contain structure motif 14!
  • They are part of the CRISPRmap database.
 
RNAz alignment statistics:
Mean pairwise identity57.04
Shannon entropy0.92
Mean single sequence MFE-8.47
Consensus MFE-6.74
Energy contribution-4.56
Covariance contribution-2.18
Mean z-score-1.64
Structure conservation index0.79
SVM RNA-class probability1
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

Your sequences are highlighted in red!

 
Alignment:
Alignment of structure motif no. 14
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 14
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 15:
Crispr repeats35
Genomes9
Bacteria1
Archaea8
SuperclassA
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 15
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 15
 
RNAz alignment statistics:
Mean pairwise identity82.4
Shannon entropy0.39
Mean single sequence MFE-3.93
Consensus MFE-3.15
Energy contribution-2.23
Covariance contribution-0.92
Mean z-score-0.74
Structure conservation index0.8
SVM RNA-class probability0.49
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 15
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 15
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 16:
Crispr repeats33
Genomes8
Bacteria0
Archaea8
SuperclassA
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 16
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 16
 
RNAz alignment statistics:
Mean pairwise identity88.74
Shannon entropy0.26
Mean single sequence MFE-5.48
Consensus MFE-4.31
Energy contribution-3.7
Covariance contribution-0.61
Mean z-score-0.37
Structure conservation index0.79
SVM RNA-class probability0.02
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 16
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 16
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 17:
Crispr repeats29
Genomes18
Bacteria0
Archaea18
SuperclassF
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 17
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 17
 
RNAz alignment statistics:
Mean pairwise identity93.71
Shannon entropy0.15
Mean single sequence MFE-0.49
Consensus MFE-0.46
Energy contribution-0.27
Covariance contribution-0.19
Mean z-score0.35
Structure conservation index0.93
SVM RNA-class probability0.01
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 17
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 17
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 18:
Crispr repeats28
Genomes17
Bacteria16
Archaea1
SuperclassB
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 18
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 18
 
RNAz alignment statistics:
Mean pairwise identity80.28
Shannon entropy0.45
Mean single sequence MFE-12.96
Consensus MFE-13.53
Energy contribution-12.92
Covariance contribution-0.62
Mean z-score-3.43
Structure conservation index1.04
SVM RNA-class probability1
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 18
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 18
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 19:
Crispr repeats28
Genomes16
Bacteria13
Archaea3
SuperclassD
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 19
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 19
 
RNAz alignment statistics:
Mean pairwise identity54.6
Shannon entropy1.08
Mean single sequence MFE-14.68
Consensus MFE-16.38
Energy contribution-12.85
Covariance contribution-3.53
Mean z-score-2.54
Structure conservation index1.12
SVM RNA-class probability0.97
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 19
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 19
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 20:
Crispr repeats27
Genomes12
Bacteria8
Archaea4
SuperclassF
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 20
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 20
 
RNAz alignment statistics:
Mean pairwise identity58.1
Shannon entropy1.02
Mean single sequence MFE-2.53
Consensus MFE-2.64
Energy contribution-0.8
Covariance contribution-1.84
Mean z-score-1.35
Structure conservation index1.04
SVM RNA-class probability0.99
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 20
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 20
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 21:
Crispr repeats26
Genomes12
Bacteria12
Archaea0
SuperclassA
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 21
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 21
 
RNAz alignment statistics:
Mean pairwise identity72.12
Shannon entropy0.63
Mean single sequence MFE-1.45
Consensus MFE-0.49
Energy contribution0
Covariance contribution-0.49
Mean z-score-0.09
Structure conservation index0.34
SVM RNA-class probability0
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 21
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 21
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 22:
Crispr repeats24
Genomes14
Bacteria0
Archaea14
SuperclassF
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 22
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 22
 
RNAz alignment statistics:
Mean pairwise identity70.13
Shannon entropy0.66
Mean single sequence MFE-6.63
Consensus MFE-7.13
Energy contribution-6.3
Covariance contribution-0.83
Mean z-score-2.23
Structure conservation index1.08
SVM RNA-class probability0.99
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 22
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 22
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 23:
Crispr repeats23
Genomes18
Bacteria17
Archaea1
SuperclassE
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 23
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 23
 
RNAz alignment statistics:
Mean pairwise identity51.54
Shannon entropy1.18
Mean single sequence MFE-12.84
Consensus MFE-14.18
Energy contribution-11.57
Covariance contribution-2.61
Mean z-score-1.98
Structure conservation index1.1
SVM RNA-class probability0.97
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 23
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 23
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 24:
Crispr repeats21
Genomes13
Bacteria12
Archaea1
SuperclassE
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 24
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 24
 
RNAz alignment statistics:
Mean pairwise identity53.33
Shannon entropy1.11
Mean single sequence MFE-7.39
Consensus MFE-4.51
Energy contribution-3.3
Covariance contribution-1.21
Mean z-score-0.64
Structure conservation index0.61
SVM RNA-class probability0.99
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 24
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 24
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 25:
Crispr repeats19
Genomes9
Bacteria9
Archaea0
SuperclassD
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 25
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 25
 
RNAz alignment statistics:
Mean pairwise identity65.49
Shannon entropy0.81
Mean single sequence MFE-8.09
Consensus MFE-5.77
Energy contribution-5.04
Covariance contribution-0.73
Mean z-score-1.17
Structure conservation index0.71
SVM RNA-class probability1
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 25
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 25
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 26:
Crispr repeats19
Genomes19
Bacteria19
Archaea0
SuperclassE
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 26
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 26
 
RNAz alignment statistics:
Mean pairwise identity59.64
Shannon entropy0.95
Mean single sequence MFE-11.94
Consensus MFE-8.64
Energy contribution-6.42
Covariance contribution-2.23
Mean z-score-2.46
Structure conservation index0.72
SVM RNA-class probability1
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 26
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 26
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 27:
Crispr repeats17
Genomes4
Bacteria0
Archaea4
SuperclassA
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 27
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 27
 
RNAz alignment statistics:
Mean pairwise identity86.88
Shannon entropy0.26
Mean single sequence MFE-3.75
Consensus MFE-4.23
Energy contribution-3.75
Covariance contribution-0.48
Mean z-score-0.19
Structure conservation index1.13
SVM RNA-class probability0.84
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 27
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 27
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 28:
Crispr repeats1617
Genomes10
Bacteria10
Archaea0
SuperclassE
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 28
Original: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
New: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.svg]


Comments:
  • Your sequence(s) contain structure motif 28!
  • You have provided sequences, which are not part of the CRISPRmap database.
  • Statistics and figures have been updated.
 
RNAz alignment statistics:
Mean pairwise identity56.0655.16
Shannon entropy0.971.01
Mean single sequence MFE-6.39-6.49
Consensus MFE-5.91-6.04
Energy contribution-4.92-5.08
Covariance contribution-0.99-0.97
Mean z-score-0.48-0.52
Structure conservation index0.920.93
SVM RNA-class probability0.990.99
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

Your sequences are highlighted in red!

 
Alignment:
Alignment of structure motif no. 28
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 28
[.png] [.pdf] [.ps]
Update:
Updated alignment of structure motif no. 28
[.aln] [.png] [.pdf] [.ps]
Update:
Updated consensus structure of class no. 28
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 29:
Crispr repeats14
Genomes9
Bacteria5
Archaea4
SuperclassE
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 29
Original: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
New: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.svg]


Comments:
  • Your sequence(s) contain structure motif 29!
  • They are part of the CRISPRmap database.
 
RNAz alignment statistics:
Mean pairwise identity46.99
Shannon entropy1.21
Mean single sequence MFE-6.16
Consensus MFE-4.94
Energy contribution-3.37
Covariance contribution-1.57
Mean z-score-0.89
Structure conservation index0.8
SVM RNA-class probability1
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

Your sequences are highlighted in red!

 
Alignment:
Alignment of structure motif no. 29
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 29
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 30:
Crispr repeats13
Genomes8
Bacteria8
Archaea0
SuperclassD
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 30
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 30
 
RNAz alignment statistics:
Mean pairwise identity68.24
Shannon entropy0.72
Mean single sequence MFE-4.54
Consensus MFE-2.07
Energy contribution-2.24
Covariance contribution0.17
Mean z-score-0.35
Structure conservation index0.46
SVM RNA-class probability0.37
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 30
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 30
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 31:
Crispr repeats11
Genomes6
Bacteria4
Archaea2
SuperclassE
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 31
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 31
 
RNAz alignment statistics:
Mean pairwise identity52.82
Shannon entropy1.07
Mean single sequence MFE-8.54
Consensus MFE-2.28
Energy contribution-1.78
Covariance contribution-0.5
Mean z-score-1.71
Structure conservation index0.27
SVM RNA-class probability0.97
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 31
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 31
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 32:
Crispr repeats10
Genomes10
Bacteria10
Archaea0
Superclass-
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 32
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 32
 
RNAz alignment statistics:
Mean pairwise identity47.38
Shannon entropy1.13
Mean single sequence MFE-6.92
Consensus MFE-1.82
Energy contribution-0.92
Covariance contribution-0.9
Mean z-score-1.07
Structure conservation index0.26
SVM RNA-class probability0.69
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 32
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 32
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:
Details on motif 33:
Crispr repeats10
Genomes10
Bacteria8
Archaea2
SuperclassF
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 33
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 33
 
RNAz alignment statistics:
Mean pairwise identity46.93
Shannon entropy1.17
Mean single sequence MFE-2.84
Consensus MFE-2.24
Energy contribution-0.34
Covariance contribution-1.9
Mean z-score0.17
Structure conservation index0.79
SVM RNA-class probability0.95
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 33
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 33
[.png] [.pdf] [.ps]
List of majority cas genes per motif: Cas-Legend:

? Close up on sequence families

Details on family 1:
Crispr repeats289
Genomes88
Bacteria87
Archaea1
SuperclassA
Mean pairwise identity78.16
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 1
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 2:
Crispr repeats221
Genomes127
Bacteria124
Archaea2
SuperclassB
Mean pairwise identity80.69
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 2
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 3:
Crispr repeats210
Genomes134
Bacteria133
Archaea1
SuperclassD
Mean pairwise identity68.11
Sequences with full names[.fasta]
Comments:
  • Your sequence(s) belong to sequence family 3!
  • They are part of the CRISPRmap database.
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 4:
Crispr repeats172
Genomes105
Bacteria100
Archaea5
SuperclassC
Mean pairwise identity71.07
Sequences with full names[.fasta]
Comments:
  • Your sequence(s) belong to sequence family 4!
  • They are part of the CRISPRmap database.
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 5:
Crispr repeats135
Genomes91
Bacteria91
Archaea0
SuperclassC
Mean pairwise identity88.89
Sequences with full names[.fasta]
Comments:
  • Your sequence(s) belong to sequence family 5!
  • They are part of the CRISPRmap database.
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 6:
Crispr repeats124
Genomes42
Bacteria42
Archaea0
SuperclassA
Mean pairwise identity76.39
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 6
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 7:
Crispr repeats108
Genomes20
Bacteria0
Archaea20
SuperclassA
Mean pairwise identity74.43
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 7
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 8:
Crispr repeats88
Genomes67
Bacteria67
Archaea0
SuperclassB
Mean pairwise identity89.19
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 8
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 9:
Crispr repeats76
Genomes20
Bacteria20
Archaea0
SuperclassA
Mean pairwise identity84.19
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 9
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 10:
Crispr repeats70
Genomes31
Bacteria1
Archaea30
SuperclassA
Mean pairwise identity80.96
Sequences with full names[.fasta]
Comments:
  • Your sequence(s) belong to sequence family 10!
  • They are part of the CRISPRmap database.
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 11:
Crispr repeats49
Genomes21
Bacteria0
Archaea21
SuperclassF
Mean pairwise identity73.6
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 11
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 12:
Crispr repeats45
Genomes21
Bacteria21
Archaea0
SuperclassE
Mean pairwise identity95.86
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 12
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 13:
Crispr repeats44
Genomes24
Bacteria0
Archaea24
SuperclassF
Mean pairwise identity87
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 13
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 14:
Crispr repeats44
Genomes12
Bacteria0
Archaea12
SuperclassF
Mean pairwise identity79.43
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 14
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 15:
Crispr repeats42
Genomes23
Bacteria0
Archaea23
SuperclassF
Mean pairwise identity71.5
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 15
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 16:
Crispr repeats40
Genomes7
Bacteria7
Archaea0
SuperclassA
Mean pairwise identity94.45
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 16
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 17:
Crispr repeats39
Genomes20
Bacteria20
Archaea0
SuperclassF
Mean pairwise identity73.52
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 17
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 18:
Crispr repeats35
Genomes24
Bacteria24
Archaea0
SuperclassB
Mean pairwise identity75.57
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 18
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 19:
Crispr repeats32
Genomes22
Bacteria0
Archaea22
SuperclassA
Mean pairwise identity84.55
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 19
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 20:
Crispr repeats28
Genomes13
Bacteria8
Archaea5
SuperclassE
Mean pairwise identity76.44
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 20
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 21:
Crispr repeats27
Genomes21
Bacteria21
Archaea0
SuperclassC
Mean pairwise identity77.34
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 21
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 22:
Crispr repeats26
Genomes15
Bacteria15
Archaea0
SuperclassB
Mean pairwise identity88.81
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 22
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 23:
Crispr repeats24
Genomes10
Bacteria10
Archaea0
SuperclassE
Mean pairwise identity80.56
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 23
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 24:
Crispr repeats23
Genomes8
Bacteria0
Archaea8
SuperclassF
Mean pairwise identity92.26
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 24
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 25:
Crispr repeats23
Genomes16
Bacteria16
Archaea0
SuperclassA
Mean pairwise identity75.98
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 25
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 26:
Crispr repeats23
Genomes16
Bacteria5
Archaea11
SuperclassE
Mean pairwise identity81.36
Sequences with full names[.fasta]
Comments:
  • Your sequence(s) belong to sequence family 26!
  • They are part of the CRISPRmap database.
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 27:
Crispr repeats22
Genomes21
Bacteria21
Archaea0
SuperclassE
Mean pairwise identity86.72
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 27
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 28:
Crispr repeats20
Genomes12
Bacteria12
Archaea0
SuperclassA
Mean pairwise identity93.05
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 28
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 29:
Crispr repeats20
Genomes11
Bacteria0
Archaea11
SuperclassA
Mean pairwise identity85.5
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 29
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 30:
Crispr repeats19
Genomes5
Bacteria5
Archaea0
SuperclassA
Mean pairwise identity87.98
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 30
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 31:
Crispr repeats19
Genomes11
Bacteria10
Archaea1
SuperclassE
Mean pairwise identity78.89
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 31
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 32:
Crispr repeats18
Genomes13
Bacteria13
Archaea0
SuperclassD
Mean pairwise identity73.82
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 32
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 33:
Crispr repeats16
Genomes12
Bacteria12
Archaea0
SuperclassB
Mean pairwise identity68.25
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 33
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 34:
Crispr repeats15
Genomes8
Bacteria8
Archaea0
SuperclassA
Mean pairwise identity82.06
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 34
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 35:
Crispr repeats15
Genomes14
Bacteria14
Archaea0
SuperclassE
Mean pairwise identity92.8
Sequences with full names[.fasta]
Comments:
  • Your sequence(s) belong to sequence family 35!
  • They are part of the CRISPRmap database.
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 36:
Crispr repeats15
Genomes5
Bacteria5
Archaea0
SuperclassF
Mean pairwise identity94
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 36
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 37:
Crispr repeats14
Genomes9
Bacteria9
Archaea0
SuperclassD
Mean pairwise identity76.03
Sequences with full names[.fasta]
Comments:
  • Your sequence(s) belong to sequence family 37!
  • They are part of the CRISPRmap database.
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 38:
Crispr repeats13
Genomes8
Bacteria1
Archaea7
SuperclassF
Mean pairwise identity85.98
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 38
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 39:
Crispr repeats13
Genomes9
Bacteria9
Archaea0
SuperclassE
Mean pairwise identity76.26
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 39
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:
Details on family 40:
Crispr repeats13
Genomes13
Bacteria13
Archaea0
SuperclassF
Mean pairwise identity85.73
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 40
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
List of majority cas genes per family: Cas-Legend:

? Downloads

Download an archive file containing the complete results produced by the job in [.zip] format.
Downloading Annotations of all CAS gene [.tab] format.

? CRISPRmap version used for prediction

/scratch/rna/bisge001/Software/CRISPRmap/v0.1/main.sh v1.0-2013 : 3527 consensus repeats covering 40 families and 33 structural motifs

Input and runtime details for job 8888684 (precomputed example)

Input Parameters

? Sequence Input in FASTA Format[.fa]
? Optimize reading direction of input sequencesyes

Job ID 8888684 (server version 3.4.2)

?Job Submitted & Queued@ Mon Dec 15 05:10:37 CET 2014
?Processing Started@ Mon Dec 15 05:10:45 CET 2014
?CRISPRmap Finished & Post-Processing@ Mon Dec 15 05:25:05 CET 2014
?Job Completed@ Mon Dec 15 05:25:25 CET 2014
 DIRECT ACCESS: http://rna.informatik.uni-freiburg.de:80/RetrieveResults.jsp?jobID=8888684&toolName=CRISPRmap ( 30 days expiry )

When using CRISPRmap please cite :