Freiburg RNA Tools
CRISPRmap
BIF
IFF
CRISPRmap 0788874
Select Structure Motif
Select Sequence Family

? CRISPRmap tree of consensus CRISPR sequences

The CRISPRmap
The CRISPRmap
Zoom: View:
Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Structure motifs Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families Sequence families The CRISPRmap - legend
CRISPRmap download: [.jpg] [.pdf] [.svg]

? Class assignments -- orientation not predicted

IDInputStructuresSequencesSuperclass
1UserId=Repeat1
GCATGCTGCGCGTGCGCGCGGGACTGCC
- - B
2UserId=Repeat2
GTCGCCCTCCTCGCGGAGGGCGTGGATAGAAA
- - C
3UserId=Repeat3
GAATCTCAAAGAGAGGATTGAAAC
- - D
4UserId=Repeat4
GTCTCCTTTACCACTTCCCCGAGAGGGGATTGAAAG
motif 4 - E
5UserId=Repeat5
TTTCCGATTTTTCGGCTCGCAGAAGAGCACTGAAA
motif 17 - E
6UserId=Repeat6
GATGCAACTAAGAAAGAATTGAAGC
- - D
7UserId=Repeat7 CRISPRmap=Tequ_A_G_3_X_F6
TTAACTACCGTATAGGTAGTTTAGA
- family 6 -
8UserId=Repeat8
GTCTCAACGGCCTAAGCGGCCAGCGGGTCTGAAA
- - C

? Close up on structure motifs

Details on motif 1:
Crispr repeats498
Genomes249
Bacteria245
Archaea4
SuperclassSclB
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 1
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 1
 
RNAz alignment statistics:
Mean pairwise identity76.24
Shannon entropy0.57
Mean single sequence MFE-14.52
Consensus MFE-13.2
Energy contribution-12.78
Covariance contribution-0.43
Mean z-score-2.71
Structure conservation index0.91
SVM RNA-class probability1
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 1
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 1
[.png] [.pdf] [.ps]
Details on motif 2:
Crispr repeats264
Genomes150
Bacteria150
Archaea0
SuperclassSclB
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 2
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 2
 
RNAz alignment statistics:
Mean pairwise identity85.77
Shannon entropy0.37
Mean single sequence MFE-8.57
Consensus MFE-5.74
Energy contribution-5.32
Covariance contribution-0.42
Mean z-score-1.99
Structure conservation index0.67
SVM RNA-class probability0.93
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 2
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 2
[.png] [.pdf] [.ps]
Details on motif 3:
Crispr repeats247
Genomes177
Bacteria174
Archaea3
SuperclassSclC
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 3
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 3
 
RNAz alignment statistics:
Mean pairwise identity72.8
Shannon entropy0.68
Mean single sequence MFE-13.27
Consensus MFE-14.56
Energy contribution-12.63
Covariance contribution-1.93
Mean z-score-2.43
Structure conservation index1.1
SVM RNA-class probability0.98
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 3
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 3
[.png] [.pdf] [.ps]
Details on motif 4:
Crispr repeats222223
Genomes105
Bacteria105
Archaea0
SuperclassSclE
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 4
Original: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
New: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.svg]


Comments:
  • Your sequence(s) contain structure motif 4!
  • You have provided sequences, which are not part of the CRISPRmap database.
  • Statistics and figures have been updated.
 
RNAz alignment statistics:
Mean pairwise identity56.0852.84
Shannon entropy1.071.15
Mean single sequence MFE-11.65-11.65
Consensus MFE-7.63-7.63
Energy contribution-6.81-6.82
Covariance contribution-0.81-0.81
Mean z-score-2.09-2.09
Structure conservation index0.650.65
SVM RNA-class probability11
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

Your sequences are highlighted in red!

 
Alignment:
Alignment of structure motif no. 4
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 4
[.png] [.pdf] [.ps]
Update:
Updated alignment of structure motif no. 4
[.aln] [.png] [.pdf] [.ps]
Update:
Updated consensus structure of class no. 4
[.png] [.pdf] [.ps]
Details on motif 5:
Crispr repeats138
Genomes88
Bacteria83
Archaea5
SuperclassSclC
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 5
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 5
 
RNAz alignment statistics:
Mean pairwise identity42.63
Shannon entropy1.39
Mean single sequence MFE-16.63
Consensus MFE-16.95
Energy contribution-12.78
Covariance contribution-4.17
Mean z-score-3.3
Structure conservation index1.02
SVM RNA-class probability0.99
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 5
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 5
[.png] [.pdf] [.ps]
Details on motif 6:
Crispr repeats119
Genomes28
Bacteria28
Archaea0
SuperclassSclA
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 6
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 6
 
RNAz alignment statistics:
Mean pairwise identity83.98
Shannon entropy0.4
Mean single sequence MFE-1.61
Consensus MFE-0.1
Energy contribution0.23
Covariance contribution-0.33
Mean z-score0.15
Structure conservation index0.06
SVM RNA-class probability0
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 6
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 6
[.png] [.pdf] [.ps]
Details on motif 7:
Crispr repeats117
Genomes89
Bacteria87
Archaea2
SuperclassSclB
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 7
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 7
 
RNAz alignment statistics:
Mean pairwise identity70.39
Shannon entropy0.74
Mean single sequence MFE-13.66
Consensus MFE-13.51
Energy contribution-12.83
Covariance contribution-0.67
Mean z-score-2.79
Structure conservation index0.99
SVM RNA-class probability1
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 7
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 7
[.png] [.pdf] [.ps]
Details on motif 8:
Crispr repeats99
Genomes32
Bacteria32
Archaea0
SuperclassSclE
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 8
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 8
 
RNAz alignment statistics:
Mean pairwise identity76.15
Shannon entropy0.58
Mean single sequence MFE-7.63
Consensus MFE-3.7
Energy contribution-3.61
Covariance contribution-0.09
Mean z-score-1.91
Structure conservation index0.49
SVM RNA-class probability0.98
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 8
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 8
[.png] [.pdf] [.ps]
Details on motif 9:
Crispr repeats80
Genomes39
Bacteria14
Archaea25
SuperclassSclE
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 9
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 9
 
RNAz alignment statistics:
Mean pairwise identity73.44
Shannon entropy0.65
Mean single sequence MFE-4.13
Consensus MFE-1.76
Energy contribution-1.68
Covariance contribution-0.08
Mean z-score-0.48
Structure conservation index0.43
SVM RNA-class probability0.16
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 9
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 9
[.png] [.pdf] [.ps]
Details on motif 10:
Crispr repeats75
Genomes23
Bacteria0
Archaea23
SuperclassSclD
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 10
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 10
 
RNAz alignment statistics:
Mean pairwise identity73.59
Shannon entropy0.62
Mean single sequence MFE-2.5
Consensus MFE-3.19
Energy contribution-2.16
Covariance contribution-1.03
Mean z-score-0.16
Structure conservation index1.27
SVM RNA-class probability0.61
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 10
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 10
[.png] [.pdf] [.ps]
Details on motif 11:
Crispr repeats54
Genomes19
Bacteria14
Archaea5
SuperclassSclD
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 11
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 11
 
RNAz alignment statistics:
Mean pairwise identity51.52
Shannon entropy1.21
Mean single sequence MFE-3.43
Consensus MFE-3.64
Energy contribution-1.34
Covariance contribution-2.3
Mean z-score-1.74
Structure conservation index1.06
SVM RNA-class probability0.98
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 11
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 11
[.png] [.pdf] [.ps]
Details on motif 12:
Crispr repeats44
Genomes18
Bacteria12
Archaea6
SuperclassSclA
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 12
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 12
 
RNAz alignment statistics:
Mean pairwise identity62.74
Shannon entropy0.88
Mean single sequence MFE-4.04
Consensus MFE-3.66
Energy contribution-2.35
Covariance contribution-1.31
Mean z-score-0.27
Structure conservation index0.91
SVM RNA-class probability0.97
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 12
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 12
[.png] [.pdf] [.ps]
Details on motif 13:
Crispr repeats31
Genomes18
Bacteria18
Archaea0
SuperclassSclA
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 13
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 13
 
RNAz alignment statistics:
Mean pairwise identity87.51
Shannon entropy0.28
Mean single sequence MFE-2.29
Consensus MFE-1.16
Energy contribution-0.77
Covariance contribution-0.38
Mean z-score-0.08
Structure conservation index0.5
SVM RNA-class probability0
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 13
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 13
[.png] [.pdf] [.ps]
Details on motif 14:
Crispr repeats26
Genomes13
Bacteria9
Archaea4
SuperclassSclE
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 14
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 14
 
RNAz alignment statistics:
Mean pairwise identity50.43
Shannon entropy1.16
Mean single sequence MFE-8.5
Consensus MFE-5.74
Energy contribution-4.22
Covariance contribution-1.53
Mean z-score-1.3
Structure conservation index0.68
SVM RNA-class probability1
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 14
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 14
[.png] [.pdf] [.ps]
Details on motif 15:
Crispr repeats21
Genomes13
Bacteria13
Archaea0
SuperclassSclF
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 15
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 15
 
RNAz alignment statistics:
Mean pairwise identity66.5
Shannon entropy0.74
Mean single sequence MFE-7.06
Consensus MFE-7.48
Energy contribution-5.11
Covariance contribution-2.37
Mean z-score-1.27
Structure conservation index1.06
SVM RNA-class probability0.97
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 15
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 15
[.png] [.pdf] [.ps]
Details on motif 16:
Crispr repeats20
Genomes12
Bacteria12
Archaea0
SuperclassSclE
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 16
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 16
 
RNAz alignment statistics:
Mean pairwise identity63.3
Shannon entropy0.88
Mean single sequence MFE-7.6
Consensus MFE-6.74
Energy contribution-6.37
Covariance contribution-0.38
Mean z-score-0.47
Structure conservation index0.89
SVM RNA-class probability0.99
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 16
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 16
[.png] [.pdf] [.ps]
Details on motif 17:
Crispr repeats1516
Genomes8
Bacteria8
Archaea0
SuperclassSclE
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 17
Original: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
New: [.newick] [.jpg] [.pdf] [.svg] Dendgram[.svg]


Comments:
  • Your sequence(s) contain structure motif 17!
  • You have provided sequences, which are not part of the CRISPRmap database.
  • Statistics and figures have been updated.
 
RNAz alignment statistics:
Mean pairwise identity55.4755.44
Shannon entropy11.01
Mean single sequence MFE-6.7-6.8
Consensus MFE-6.01-6.14
Energy contribution-4.75-4.85
Covariance contribution-1.26-1.29
Mean z-score-0.75-0.76
Structure conservation index0.90.9
SVM RNA-class probability0.990.99
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

Your sequences are highlighted in red!

 
Alignment:
Alignment of structure motif no. 17
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 17
[.png] [.pdf] [.ps]
Update:
Updated alignment of structure motif no. 17
[.aln] [.png] [.pdf] [.ps]
Update:
Updated consensus structure of class no. 17
[.png] [.pdf] [.ps]
Details on motif 18:
Crispr repeats10
Genomes9
Bacteria8
Archaea1
SuperclassSclF
Sequences with full names[.fasta]
Clustering tree:
Subtree of structure motif no. 18
 [.newick] [.jpg] [.pdf] [.svg] Dendgram[.pdf]
  


Comments:
  • None of your sequences exhibit motif no. 18
 
RNAz alignment statistics:
Mean pairwise identity66.09
Shannon entropy0.72
Mean single sequence MFE-4.98
Consensus MFE-4.89
Energy contribution-4.35
Covariance contribution-0.54
Mean z-score-1.17
Structure conservation index0.98
SVM RNA-class probability0.99
 
Tree-Legend:
(from inside to outside)

Structure motifs
Sequence families
Cas subtypes 2005
Cas subtypes 2011
Taxonomic classes
Taxonomic domains
Superclasses

 
Alignment:
Alignment of structure motif no. 18
[.aln] [.png] [.pdf] [.ps]
Consensus MFE structure:
Consensus structure of class no. 18
[.png] [.pdf] [.ps]

? Close up on sequence families

Details on family 1:
Crispr repeats671
Genomes336
Bacteria326
Archaea10
SuperclassSclB
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 1
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 2:
Crispr repeats556
Genomes162
Bacteria158
Archaea4
SuperclassSclA
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 2
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 3:
Crispr repeats402
Genomes102
Bacteria7
Archaea95
SuperclassSclD
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 3
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 4:
Crispr repeats329
Genomes83
Bacteria6
Archaea77
SuperclassSclA
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 4
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 5:
Crispr repeats296
Genomes209
Bacteria206
Archaea3
SuperclassSclC
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 5
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 6:
Crispr repeats264
Genomes151
Bacteria151
Archaea0
SuperclassSclB
Sequences with full names[.fasta]
Comments:
  • Your sequence(s) belong to sequence family 6!
  • They are part of the CRISPRmap database.
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 7:
Crispr repeats235
Genomes74
Bacteria68
Archaea6
SuperclassSclA
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 7
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 8:
Crispr repeats175
Genomes89
Bacteria79
Archaea10
SuperclassSclE
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 8
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 9:
Crispr repeats146
Genomes46
Bacteria43
Archaea3
SuperclassSclE
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 9
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 10:
Crispr repeats89
Genomes43
Bacteria17
Archaea26
SuperclassSclE
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 10
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 11:
Crispr repeats76
Genomes39
Bacteria37
Archaea2
SuperclassSclE
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 11
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 12:
Crispr repeats68
Genomes45
Bacteria8
Archaea37
SuperclassSclA
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 12
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 13:
Crispr repeats61
Genomes55
Bacteria55
Archaea0
SuperclassSclF
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 13
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 14:
Crispr repeats53
Genomes29
Bacteria24
Archaea5
SuperclassSclC
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 14
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 15:
Crispr repeats45
Genomes18
Bacteria3
Archaea15
SuperclassSclA
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 15
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 16:
Crispr repeats45
Genomes14
Bacteria2
Archaea12
SuperclassSclD
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 16
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 17:
Crispr repeats38
Genomes23
Bacteria23
Archaea0
SuperclassSclE
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 17
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 18:
Crispr repeats36
Genomes19
Bacteria19
Archaea0
SuperclassSclC
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 18
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 19:
Crispr repeats29
Genomes28
Bacteria28
Archaea0
SuperclassSclF
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 19
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 20:
Crispr repeats26
Genomes16
Bacteria16
Archaea0
SuperclassSclD
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 20
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 21:
Crispr repeats25
Genomes23
Bacteria23
Archaea0
Superclass-
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 21
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 22:
Crispr repeats19
Genomes19
Bacteria19
Archaea0
SuperclassSclF
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 22
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 23:
Crispr repeats14
Genomes13
Bacteria13
Archaea0
SuperclassSclF
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 23
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]
Details on family 24:
Crispr repeats11
Genomes11
Bacteria11
Archaea0
SuperclassSclE
Sequences with full names[.fasta]
Comments:
  • None of your sequences belongs to family no. 24
 
Sequence logo of all aligned family members:
Alignment [.aln] Sequence logo[.png] [.pdf] [.eps]

? Downloads

Download an archive file containing the complete results produced by the job in [.zip] format.
Downloading Annotations of all CAS gene [.tab] format.

? CRISPRmap version used for prediction

/scratch/rna/bisge001/Software/CRISPRmap/2.1/main.sh v2.1-2014 : 4719 consensus repeats covering 24 families and 18 structural motifs

Input and runtime details for job 0788874 (precomputed example)

Input Parameters

? Sequence Input in FASTA Format[.fa]
? Optimize reading direction of input sequencesno

Job ID 0788874 (server version 3.4.2)

?Job Submitted & Queued@ Mon Dec 15 12:36:20 CET 2014
?Processing Started@ Mon Dec 15 12:36:31 CET 2014
?CRISPRmap Finished & Post-Processing@ Mon Dec 15 13:02:26 CET 2014
?Job Completed@ Mon Dec 15 13:02:36 CET 2014
 DIRECT ACCESS: http://rna.informatik.uni-freiburg.de:80/RetrieveResults.jsp?jobID=0788874&toolName=CRISPRmap ( 30 days expiry )

When using CRISPRmap please cite :