Freiburg RNA Tools
AntaRNA - Results
BIF
IFF
AntaRNA 7036761

Input and runtime details for job 7036761 (precomputed example)

Constraints

? Structure constraintAAAAAAAAAACCCCCCC(((((....(((((....(((.....))).)))))....)))))CCCCCCCBBBBBBBBBB
? Sequence constraintnot provided
? Targeted GC-content [0..1]0.6
? Maximum for uniform distribution samplingnot provided
? Variance for normal distribution samplingnot provided

Constraint

? Allow GU base pairsyes
? Allow pseudoknotsno

Energy

? Folding temperature37.0

AntaRNA

? Max. terrain resets5
? Convergence counts130
? Ant termination criterion50
? Probability weight alpha1.0
? Probability weight beta1.0
? Pheromone evaporation rate0.2
? Constraint weight structure0.5
? Constraint weight sequence1.0
? Constraint weight GC-value5.0
? Random seednot provided

Output

? Number of sequences10

Job ID 7036761 (server version 4.0.0)

?Job Submitted & Queued@ Fri Jun 19 13:31:08 CEST 2015
?Processing Started@ Fri Jun 19 13:31:22 CEST 2015
?AntaRNA Finished & Post-Processing@ Fri Jun 19 13:41:57 CEST 2015
?Post-Processing Finished@ Fri Jun 19 13:41:58 CEST 2015
?Job Completed@ Fri Jun 19 13:41:58 CEST 2015
 DIRECT ACCESS: http://rna.informatik.uni-freiburg.de:80/RetrieveResults.jsp?jobID=7036761&toolName=AntaRNA ( 30 days expiry )

The job description you specified

Design a SECIS element with flexible stem length (block C) and flanking context (blocks A and B). See Help page for further information.

? Output download complete results [zip]

Designed sequences

Name Sequence & mfe GC% dStr% dSeq% dGC%
Target AAAAAAAAAACCCCCCC(((((....(((((....(((.....))).)))))....)))))CCCCCCCBBBBBBBBBB 60.0
antaRNA_0 ACCCCUAUAGCCGAGCCCACCCAAAAACGGAACCCCGCGUGUAGCGAUCCGUCCUCGGGUGAUGGAACCUGAAAGCCU
...............(((((((....(((((....(((.....))).)))))....)))))..)).............
60.2 2.5 0.0 0.0
antaRNA_1 CGACACUCACAUAGGACGGCACUUGCCGACGCAUUGGCGUUCUGCCCCGUCGAACUGUGCCACAACCACCCCAAACUC
.............((..(((((....(((((....(((.....))).)))))....)))))....))...........
60.2 2.5 0.0 0.0
antaRNA_2 CCCCUCUGGGUCUAGAACCCCCUAAAUGCCAACGAGACGUGCAGUCAUGGCACUCUGGGGGCUCCGUUCAAGCUCGUG
(((....)))....((.(((((....(((((....(((.....))).)))))....))))).))..............
60.2 1.2 0.0 0.0
antaRNA_3 AGGAAAUCCAACACAGCGCGCUAUACCCGAAAACGCCCGAACUGGGAUUCGGCCCAGGCGCACCCCACACAGCUAAAC
.((....))......(.(((((....(((((....(((.....))).)))))....))))).)...............
58.9 1.2 0.0 0.0
antaRNA_4 CGCACCCCAAUCCCAGAGCGCCGUCACCUCCCCUGACAAGAACUGUAGGAGGCACAGGCGCUGAACAACUCAUUGAGA
................((((((....(((((....(((.....))).)))))....))))))......(((...))).
58.9 1.2 0.0 0.0
antaRNA_5 CCGACGGGCUUACGGCAGCCCAUACUGCGCUGGUAAUCGAAAUGAUAGGCGUACGCUGGGCGCCCACUUUGACUUCAC
((....)).....(((.(((((...((((((....(((.....))).))))))...))))))))..............
58.9 2.5 0.0 0.0
antaRNA_6 CCGGAACCGGCAAUCCUCGCUUAAUACGCUCGAUCCAGGCCGACUGAGGGCGCAAGAAGUGCUGACACCACUCUAAGG
(((....)))...((..(((((....(((((....(((.....))).)))))....)))))..)).............
58.9 1.2 0.0 0.0
antaRNA_7 UGCCCCAUUCCAGAUUAGACCACCAUACGCUACAUGCCCCCGAGGCCGGCGUUCCCUGGUUCCCCUGACGUUUUACGA
..........(((....(((((....(((((....(((.....))).)))))....)))))...))).(((...))).
58.9 1.2 0.0 0.0
antaRNA_8 ACCAUACCACCAACCGACGGCUUACGGCACCUGUAGGCGAAAAGCCCGGUGUGAACGGCCGAGGUACAUACCGAUCCG
............(((..(((((....(((((....(((.....))).)))))....))))).))).............
60.2 2.5 0.0 0.0
antaRNA_9 AUCCUCACAGCCUUUGUGGGCUCAUGCCGCCCCGAGCCCUCAAGGUAGGCGGAGAUAGCCCAUCACAGUUCCAAACGU
...............(((((((....(((((....(((.....))).)))))....)))))))...............
58.9 2.5 0.0 0.0


Download:

Visualization of the selected sequence

[save as SVG] Explicit constraint violations are highlighted in red. Visualization done with forna (Kerpedjiev et al., 2015)

Job resubmission

Use the following button if you want to resubmit the job with altered input or parameterization:
Feeds the job parameters to the input page to resubmit the job.

de.NBI usability assessment

Please support us by filling this short quality survey for evaluating this de.NBI service.

When using AntaRNA please cite :

Results are computed with AntaRNA version 1.1.2 using Vienna RNA package 2.1.8 or pKiss (2014-03-17)