Input and runtime details for job 7495372 (precomputed example)

Constraints

	Structure constraint		.(((....[[[[[)))..]]]]]......
	Sequence constraint		NGNNGNNNNNNNANGNUNNNNNNUNNNNU
	Targeted GC-content [0..1]		0.4
	Maximum for uniform distribution sampling		not provided
	Variance for normal distribution sampling		not provided

Constraint

	Allow GU base pairs		yes
	Allow pseudoknots		yes

Energy

Folding temperature

37.0

AntaRNA

	Max. terrain resets		5
	Convergence counts		130
	Ant termination criterion		50
	Probability weight alpha		1
	Probability weight beta		1
	Pheromone evaporation rate		0.2
	Constraint weight structure		0.5
	Constraint weight sequence		1
	Constraint weight GC-value		5
	Random seed		not provided

Output

Number of sequences

Job ID 7495372 (server version 4.0.0)

	Job Submitted & Queued		@ Fri Jun 19 13:30:44 CEST 2015
	AntaRNA Started		@ Fri Jun 19 13:30:52 CEST 2015
	AntaRNA Finished & Post-Processing		@ Fri Jun 19 13:31:09 CEST 2015
	Post-Processing Finished		@ Fri Jun 19 13:31:10 CEST 2015
	Job Completed		@ Fri Jun 19 13:31:11 CEST 2015

DIRECT ACCESS: http://rna.informatik.uni-freiburg.de/RetrieveResults.jsp?jobID=7495372&toolName=AntaRNA ( 30 days expiry )

Description of the job

Design sequences for the crossing pseudoknot structures PKB298 with low GC-content.

Output download complete results [zip]

Designed sequences

Name	Sequence & mfe	GC%	dStr%	dSeq%	dGC%
Target	NGNNGNNNNNNNANGNUNNNNNNUNNNNU .(((....[[[[[)))..]]]]]......	40.0
antaRNA_0	CGCAGCAUAUAGAUGCUCUCUGUUUUUGU .[[[....{{{{{]]]..}}}}}......	41.3	0.0	0.0	0.0
antaRNA_1	GGCCGGAUGCUAAGGUUAUUAGUUUAUGU .[[[....{{{{{]]]..}}}}}......	41.3	0.0	0.0	0.0
antaRNA_2	AGCGGUUUCACAAUGUUCUUGUGUUUGUU .[[[....{{{{{]]]..}}}}}......	37.9	0.0	0.0	0.0
antaRNA_3	UGUCGUCUACUGAGGCUCUUAGUUGUAAU .[[[....{{{{{]]]..}}}}}......	41.3	0.0	0.0	0.0
antaRNA_4	CGCCGUAUCUAAAGGCUAUUUGGUAGAAU .[[[....{{{{{]]]..}}}}}......	41.3	0.0	0.0	0.0
antaRNA_5	GGCCGUACACUAAGGUUAUUGGUUUGUAU .[[[....{{{{{]]]..}}}}}......	41.3	0.0	0.0	0.0
antaRNA_6	CGUAGUAUGAAGAUGCUCUCUUCUAAAGU .[[[....{{{{{]]]..}}}}}......	37.9	0.0	0.0	0.0
antaRNA_7	CGUCGUCUAAUGAGGCUGUCAUUUCAAUU .[[[....{{{{{]]]..}}}}}......	41.3	0.0	0.0	0.0
antaRNA_8	GGUCGACUCAUUAGGCUUUGGUGUAUUAU .[[[....{{{{{]]]..}}}}}......	41.3	0.0	0.0	0.0
antaRNA_9	CGUCGUCUUGAAAGGCUAUUUCAUUGAUU .[[[....{{{{{]]]..}}}}}......	37.9	0.0	0.0	0.0

Download:

Visualization of the selected sequence

[save as SVG] Explicit constraint violations are highlighted in red. Visualization done with forna (Kerpedjiev et al., 2015)

Job resubmission

Use the following button if you want to resubmit the job with altered input or parameterization:

usability assessment

Please support us by filling this short quality survey for evaluating this

service.

When using AntaRNA please cite :

Robert Kleinkauf, Martin Mann and Rolf Backofen
AntaRNA - Ant Colony Based RNA Sequence Design
Bioinformatics, 31(19), pages 3114-3121, 2015.
Robert Kleinkauf, Torsten Houwaart, Rolf Backofen, and Martin Mann
AntaRNA - multi-objective inverse folding of pseudoknot RNA using ant-colony optimization
BMC Bioinformatics, 16(1), pages 1-7, 2015.
Martin Raden, Syed M Ali, Omer S Alkhnbashi, Anke Busch, Fabrizio Costa, Jason A Davis, Florian Eggenhofer, Rick Gelhausen, Jens Georg, Steffen Heyne, Michael Hiller, Kousik Kundu, Robert Kleinkauf, Steffen C Lott, Mostafa M Mohamed, Alexander Mattheis, Milad Miladi, Andreas S Richter, Sebastian Will, Joachim Wolff, Patrick R Wright, and Rolf Backofen
Freiburg RNA tools: a central online resource for RNA-focused research and teaching
Nucleic Acids Research, 46(W1), W25-W29, 2018.

Results are computed with AntaRNA version 1.1.2 using Vienna RNA package 2.1.8 or pKiss (2014-03-17)

Main Menu

Freiburg RNA Tools

Interaction Prediction

Seq-Str Alignment

CRISPR

Sequence Design

Splicing

SNP & Mutation

Classification

Gene set extension

MoDPepInt Server

CPSP-Tools Server

Galaxy-FR

CMV server

Teaching