Freiburg RNA Tools
MARNA - Results
BIF
IFF
MARNA 4842626

Input and runtime details for job 4842626 (precomputed example)

General Parameters

? Sequence Input in FASTA Format[.fa]
? Structure Computation minimum free energy structure (RNAfold, default)
? Scoresnone

Scoring Parameters

? arc removing2.0
? arc breaking1.0
? arc mismatch2.0
? base deletion1.5
? base mismatch1.8

Job ID 4842626 (server version unknown)

?Job Submitted & Queued@ Fri Jan 11 16:14:14 CET 2013
?Processing Started@ Fri Jan 11 16:14:27 CET 2013
?MARNA Finished & Post-Processing@ Fri Jan 11 16:14:31 CET 2013
?Job Completed@ Fri Jan 11 16:14:32 CET 2013
 DIRECT ACCESS: http://rna.informatik.uni-freiburg.de:80/RetrieveResults.jsp?jobID=4842626&toolName=MARNA ( 30 days expiry )

The job description you specified

tRNA alignment example

Output

download full results [.zip]

Results

Input sequences :


>AB013372
GCGCCCGUAGCUCAAUUGGAUAGAGCGUUUGACUACGGAUCAAAAGGUUAGGGGUUCGACUCCUCUCGGGCGCG
(((((((..((((.........)))).((((((....).))))).....(((((.....)))))..))))))).
>AB013373
GCGGAAGUAGUUCAGUGGUAGAACACCACCUUGCCAAGGUGGGGGUCGCGGGUUCGAAUCCCGUCUUCCGCU
(((((((..((((.......)))).((((((.....)))))).....(((((.......)))))))))))).
>AE000930
GGCCCGUAGCUCAGACUGGGAGAGCGCCGCCCUUGCAAGGCGGAGGCCCCGGGUUCAAAUCCCGGUGGGUCCA
(((((...((((.........)))).(((((.......))))).....(((((.......))))).)))))..
>AB067577
GGGCUAUUAGCUCAGGUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCCCUGGUUCAAGUCCAGGAUGGCCCA
((((((...((((.........)))).(((((.......))))).....(((((.......))))).)))))).
>AF034440
GUUGAUGUAGCUUAACCCAAAGCAAGGCACUGAAAAUGCCUAGAUGAGUCUCCCAACUCCAUAAACA
(((.(((..((((......)))).(((((.(....))))))....((((......))))))).))).

5 sequences found. Sequences without given structures have been assigned the minimum free energy structure.

Scores used :


base deletion (w_d) = 2
base mismatch (w_m) = 1
arc removing (w_r) = 2
arc breaking (w_b) = 1.5
arc mismatch (w_am)= 1.8

Alignment :

AB013372    GCGCCCGUAGCUCAAUUGGAUAGAGCGUUUGACUACGGAUCAAAAGGUUAGGGGUUCGACUCCUCUCGGGCGCG
AB013373 GCGGAAGUAGUUCAG-UGGU-AGAACACCACCUUGCCAAGGUGGGGGUCGCGGGUUCGAAUCCCGUCUUCCGCU
AE000930 -GGCCCGUAGCUCAGACUGGGAGAGCGCCGCCCUUGCAAGGCGGAGGCCCCGGGUUCAAAUCCCGGUGGGUCCA
AB067577 GGGCUAUUAGCUCAGGUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCCCUGGUUCAAGUCCAGGAUGGCCCA
AF034440 GUUGAUGUAGCUUAAC-CC--AAAGCAAGGCACUGAAAAUGCCUAGAUG--AGUCUCCCA-ACUC-CAUAAACA
Seq gNgcNNgUAGcUcAgNuggNNAgAgCgcNNcccUgNNaAggNNgaGgucNcgGguUCNaaucCNgNcNggcNCa


AB013372 (((((((..((((.........)))).((((((....).))))).....(((((.....)))))..))))))).
AB013373 (((((((..((((..-....-.)))).((((((.....)))))).....(((((.......)))))))))))).
AE000930 -(((((...((((.........)))).(((((.......))))).....(((((.......))))).)))))..
AB067577 ((((((...((((.........)))).(((((.......))))).....(((((.......))))).)))))).
AF034440 (((.(((..((((...-..--.)))).(((((.(....))))))....(--(((......-))))-))).))).
Str(50%) (((((((..((((.........)))).(((((.......))))).....(((((.......)))))))))))).
Str(60%) (((((((..((((.........)))).(((((.......))))).....(((((.......)))))))))))).
Str(70%) ((((((...((((.........)))).(((((.......))))).......(((.......)))...)))))).
Str(80%) ((((((...((((.........)))).(((((.......))))).......(((.......)))...)))))).
Str(90%) .((.((...((((.........)))).(((((.......))))).......................)).))..
Str(100%) .((.((...((((.........)))).(((((.......))))).......................)).))..
A row with stars characterizes the ambigous assignment of multiple structures to a sequence.
The consensus sequence(in blue) is successively constructed column by column. A capital letter indicates
the full conservation of a nucleotide. A lowercase letter indicates a nucleotide conservation in at least
50% of all sequences. The consensus structures reflect the conservation of base-pairs in per cent
occurring in all structures.

Job resubmission

Use the following button if you want to resubmit the job with altered input or parameterization:
Feeds the job parameters to the input page to resubmit the job.

de.NBI usability assessment

Please support us by filling this short quality survey for evaluating this de.NBI service.

When using MARNA please cite :

Results are computed with MARNA version compiled at 2010-07-29 linking Vienna RNA package 1.8.4