Freiburg RNA Tools
CRISPRloci - Help
BIF
IFF

Introduction

CRISPRloci provides an automated and comprehensive in silico characteriztion of CRISPR-Cas system on bacterial and archaeal genomes. It is a full suite for CRISPR locus characteriztion that includes CRISPR array orientation, detection of conserved leaders, cas gene annotation and subtype classification.
Results are computed with CRISPRloci version 1.0.0

Overview

The following parameters are used to control the execution of CRISPRloci

Furthermore, additional information is available

Input Parameters

?  Enter Sequence in GenBank Format(gbk), OR Accession Number

CRISPRmap accepts input in the form of one or more CRISPR sequences in FASTA format. For a CRISPR array, a single single repeat sequence should be chosen that is either most common or represents the consensus of all repeat instances in the array. You can choose between directly typing in (or pasting) your FASTA formatted sequences into the text field or uploading a text file containing the FASTA formatted sequences to the web server. A FASTA sequence entry needs to have a description line (also called header line, starting with “>”), typically including a sequence ID and optionally a description, followed by the corresponding sequence in a new line. A simple example for illustration:

	
>Repeat1
GTGCTCAACGCCTTACGGCATCAATGGTTTGGACAC
>Repeat2
GTTTTAAATCAGTTAATTTCTCCTACGAGTCGAGAC
>Repeat3
ATGTTCCCCACACGTGTGGGGATGAACCG

Note that the sequence ID you choose will later be the user ID that identifies your sequence (along with an assigned ID for calculation) in the results, so you might want to consider using a unique sequence ID name. Also, only the first word in the header line (all characters up to the first space character in the line) will be used as the user ID. Moreover, if the word extends 13 characters, only the first 13 characters will be used. Currently, a maximum of 400 CRISPRs are allowed as an input.
The parameter constraints are: The input has to be in valid FASTA format. There can be multiple sequences

?  Input Options

TODO

Output Description

Image file:

Image shows CAS and CRISPR gene data.

CRISPR table:

Table shows the CRISPR Data.
CRISPR ID: details of CRISPR identification number.
Strand: Either is plus or minus.
Start Position: Gives details of start position of genes.
End Position: gives details of end position of genes
Consensus Repeat: repeat of the
Repeat Length: length of the repeats in gene
number of Repeats: total number of repeats in gene
Sub type: sub types of gene.

CRISPR map Link:

By clicking this link all the consensus repeats are feed to CRISPR map application input page to generate CRISPR map.

CRISPR gene details:

This section gives details of each CRISPR gene data. Link on the right side feeds shown CRISPR data to CRISPR Map application.

CAS gene table:

This table shows CAS gene data.
Name: Gives detailed name of the CAS gene data.
Subtype: gives subtype of the CAS gene.
Strand: Either it is forward or backward. Same will be mentioned in image.
Start position: Starting of the gene data in the image.
End Position: End point of the gene data in the image.
Length: length of the gene data.

CAS gene details:

This section give details of CAS gene sequence. Link in the right takes to NCBI page, it gives detailed information about CAS gene.

Download all:

Clicking on Download entire data will download image, CRISPR table data, CAS table data.