Freiburg RNA Tools
GLASSgo - Results
BIF
IFF
GLASSgo 7166574

Input and runtime details for job 7166574 (precomputed example)

Sequence Parameters

? Query sRNA in FASTA[.fa]

Search Parameters

? Taxon selection Proteobacteria
? Parameter setup automatic
? Maximum allowed E-value1
? Minimum allowed identity [%]58
? Structure-based filteringauto
? Structure-based filtering value2

Job ID 7166574 (server version trunk)

?Job Submitted & Queued@ Wed Jan 18 17:52:02 CET 2017
?Processing Started@ Wed Jan 18 17:52:43 CET 2017
?GLASSgo Finished & Post-Processing@ Wed Jan 18 17:56:31 CET 2017
?Post-Processing Finished@ Wed Jan 18 17:56:32 CET 2017
?Job Completed@ Wed Jan 18 17:56:32 CET 2017
 DIRECT ACCESS: http://rna.informatik.uni-freiburg.de:80/RetrieveResults.jsp?jobID=7166574&toolName=GLASSgo ( 30 days expiry )

The job description you specified

EcpR1

? Output download complete results [zip]

In the following FASTA output, the input sequence is given top-most followed by the identified homologs.
If only the input sequence is shown, no homologs could be found.

>EcpR1_Sinorhizobium_meliloti_1021
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|365177649|emb|HE616890.1|:1104750-1104920 Sinorhizobium fredii HH103 main chromosome, complete sequence-taxID:1117943
AAAGGAAGTGAGACTTCCACGATCGATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGATTCCGACATCCGCGGATTCCTCGTGCCGCAGTCGGAGCCAGCCGACCCCCTTTCGGAACGCCGCTTCGAAGGAGGCGGCGTTT
>gi|586948118|gb|CP007225.1|:1233567-1233731 Agrobacterium tumefaciens LBA4213 (Ach5) circular chromosome-taxID:1435057
CGTCAGGGGCTGGTATTGCGTAGTTTGAATGCCCCATGATGCTCAGGTCCGCCGCATCTCCTGGATCGTGGGGTCGGTCGGCTGACGATGTCCGAATCGGTTCCTCGTGCCGTGATCACATCGTTGGCCGACCGCCTTATCTCCGAAAATATTCTGTGCTTGTGC
>gi|227339586|gb|CP001389.1|:1145485-1145656 Sinorhizobium fredii NGR234, complete genome-taxID:394
TAAGGAAGTGTGACTTCCACGATCGATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGATTCCGACGTCCGCGGATTCCTCGTGCCGCAGTCGGAGCCCAGCCGACCCCCTTTCGGAACGCCGCTCCGAAGGAGGCGGCGTTT
>gi|573465242|gb|CP007045.1|:1462254-1462418 Rhizobium leguminosarum bv. trifolii WSM1689, complete genome-taxID:754523
GAGAAGCGCTCCCGTTGAGGAGTTGTCGATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTAGTAGGCAAATTATAGCGGTTCCTCGTGCCGTTTTGCATGCTGGCCGACCCCCTTTCAAGAAAACGCCGCCACTTCCCGAAG
>gi|647790312|gb|CP006986.1|:1697765-1697929 Rhizobium etli bv. mimosae str. IE4771, complete genome-taxID:1432050
GAGAAGAGCTCCCGAAGAGGAGCTGTCCATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTTGGTCGGCTGGTAGGCAAGTCATAACGGTTCCTCGTGCCGTTTTGCATGCTGGCCGACCCCCTTTCAGGAAAACGCCGTCACTTCCCGAAG
>gi|390125223|gb|CP003563.1|:3505461-3505631 Sinorhizobium fredii USDA 257, complete genome-taxID:1185652
TAAGGAAGTGTGACTTCCACGATCGATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGTTTCTGACATCCGCGGATTCCTCGTGCCGCAGTCGGAGCCAGCCGACCCCCTTTCAAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|333810283|gb|CP002740.1|:974429-974595 Sinorhizobium meliloti BL225C, complete genome-taxID:698936
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|433663430|gb|CP003358.1|:3920237-3920402 Mesorhizobium australicum WSM2073, complete genome-taxID:754035
CGAGGTAGACAGCCGGCTCGATCCTCGAATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCCGTGGGGTCGGCCGGCCGGCGCTGGCACATAGTGGCCTCCTCGTACCGCTGCCAAACGCCGACCGGCCCCCTTTGCCCGATATGACATCAGGAATCTGC
>gi|317165637|gb|CP002447.1|:c4297009-4296844 Mesorhizobium ciceri biovar biserrulae WSM1271, complete genome-taxID:765698
GATAGACCGCCGGCTCCGGTCCCTGGGAATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCCGTGGGGTCGGCCGGCCGGCGCTGGCACATAGTGGCCTCCTCGTACCGCTGCCAAACGCCGACCGGCCCCCTTCTTTCCAATGAACATCAGAGCTCCGT
>gi|336031356|gb|CP001830.1|:c2256278-2256112 Sinorhizobium meliloti SM11, complete genome-taxID:707241
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|806952473|gb|CP011246.1|:1233489-1233653 Agrobacterium tumefaciens strain Ach5 chromosome circular, complete sequence-taxID:358
CGTCAGGGGCTGGTATTGCGTAGTTTGAATGCCCCATGATGCTCAGGTCCGCCGCATCTCCTGGATCGTGGGGTCGGTCGGCTGACGATGTCCGAATCGGTTCCTCGTGCCGTGATCACATCGTTGGCCGACCGCCTTATCTCCGAAAATATTCTGTGCTTGTGC
>gi|240856645|gb|CP001622.1|:1369743-1369907 Rhizobium leguminosarum bv. trifolii WSM1325, complete genome-taxID:395491
GAGAAGCGCTCCCGTTGAGGAGTTGTCGATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTAGTAGGCAAGTTATAGCGGTTCCTCGTGCCGTTTTGCATGCTGGCCGACCCCCTTTCAAGAAAACGCCGCCACTTCCCGAAG
>gi|745831697|gb|CP006877.1|:1510097-1510264 Rhizobium gallicum bv. gallicum R602, complete genome-taxID:1418105
GAAAAGCACTCCCACTTGAGGAGTCCGCATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCCGGTCGGCTAGCTCGCAATTTTTCGCGGTTCCTCGTGCCGCCTTGCCTGCTGGCCGACCCCCTTTGCCTGAAAAACGCCGTCTTTCCCATCAC
>gi|430001947|emb|FO082820.1|:1291846-1292010 Rhizobium sp. str. NT-26 chromosome, complete genome-taxID:1125847
TAGTTTGCGCGATTTTTAGAGACGAAAGATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGATCGATTGCATGTCTCGGTTCCTCGTGCCGTATTGCAGTCGGTCGACCCCCAAATAAAAAAGCACCGCTTTCAAGGAAAGCGGTG
>gi|574588616|gb|CP007067.1|:1243708-1243872 Rhizobium leguminosarum bv. trifolii CB782, complete genome-taxID:1033991
GAGAAGCGCTCCCGCTGAGGAGTTGTCGATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTAGTAGGCAAGTTATAGCGGTTCCTCGTGCCGTTTTGCATGCTGGCCGACCCCCTTTCAAGAAAACGCCGCCACTTCCCGAAG
>gi|627771689|gb|CP007509.1|:c4292483-4292317 Pseudomonas stutzeri strain 19SMN4, complete genome-taxID:316
GCATTCGCGTTCGATTCCGTGCAGGCATTGGTTGAGCAGCGGCAGGTGTGGAGCCTCGGCCAGCAATGCCAGGCGGTGGGTGAGAAGAGCGCTCAACTTGTGGATTCCTTCACGCGACAGTCGCCCCAATATGGGGATGGAAACGCCGCTTCACAAGAGGCGGCGTT
>gi|873266605|gb|CP003933.2|:1383304-1383470 Sinorhizobium meliloti GR4, complete genome-taxID:1235461
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|657121522|gb|CP006581.1|:c2485065-2484900 Mesorhizobium huakuii 7653R genome-taxID:763057
GAGTAGACAACCGGCTCGATCCCTAGAAATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCCGTGGGGTCGGCCGGCCGGCGCTGGCACATAGTGGCCTCCTCGTACCGCTGCCAAACGCCGACCGGCCCCCTTCCTCCAAACAGAACATCAGAACTTCG
>gi|110283346|gb|CP000390.1|:1442015-1442183 Chelativorans sp. BNC1, complete genome-taxID:266779
CTGGACATAATGTACGGTTGCCGCTCAAATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCCGTGGGGTTGGCCGGTTGGTGCTGGTGTTAGTGGCCTCCTCGTACCGCAGCCAGTTGCCAGCCGGCCCCCAACAGCGCGCCAATCTGCCCTCTCATCTTTTC
>gi|336024847|gb|CP002279.1|:4209480-4209645 Mesorhizobium opportunistum WSM2075, complete genome-taxID:536019
AGGATAGATAGCCGGCTCGATCCCCAGAATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCCGTGGGGTCGGCCGGCCGGCGCTGGCAAATAGTGGCCTCCTCGTACCGCTGCCAAACGCCGACCGGCCCCCTTTCCTGAAAATGACATCAGGACTCTGC
>gi|334093764|gb|CP002781.1|:1110062-1110228 Sinorhizobium meliloti AK83 chromosome 1, complete sequence-taxID:693982
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|30407155|emb|AL591688.1|:1411678-1411844 Sinorhizobium meliloti 1021 complete chromosome-taxID:266834
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|549124460|emb|HG518322.1|:1251154-1251318 Rhizobium sp. IRBG74 circular chromosome, complete genome-taxID:424182
TGTCAGGGGCTGGTTTTGCGTAGTTTGAATGCCCCATGATGCTCAGGTCCGCCGCATCTCCTGAATCGTGGGGTCGGTCGGCTGACGATGTTCGATTCGGTTCCTCGTGCCGTAACGCATCGTTGGCCGGCCGCCTTATTCCCTGCTTGATGCGTTGCAGCATCG
>gi|675826159|gb|CP009144.1|:1399641-1399807 Sinorhizobium meliloti strain RMO17, complete genome-taxID:382
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|150026743|gb|CP000738.1|:1002522-1002690 Sinorhizobium medicae WSM419, complete genome-taxID:366394
GCGAGGAAGGAAACTTCCACAGCAATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGATTTGCGGATTCCTCGTGCTGCAACCGGAACCAGCCGACCCCCATTCGAAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|407317441|emb|HE995405.1|:1053842-1054008 Sinorhizobium meliloti Rm41 complete genome-taxID:1230587
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|209533368|gb|CP001191.1|:1311538-1311702 Rhizobium leguminosarum bv. trifolii WSM2304, complete genome-taxID:395492
GAGAAGCGCTCCCGCTGAGGAGTTGTCGATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTAGTAGGCAAGTTATAGCGGTTCCTCGTGCCGTTTTGCATGCTGGCCGACCCCCTTTCAAGAAAACGCCGCCACTTCCCGAAG
>gi|221721649|gb|CP000628.1|:1499282-1499455 Agrobacterium radiobacter K84 chromosome 1, complete sequence-taxID:311403
TACAGAGATAGCCCGCAAGGGTTTGAGAATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCAGGCAATTTCAAGCGGTTCCTCGTGCCGTTTTGCAGGCTAGCCGGCCCCCGATTTAAAACGCCGCTCTTCCTATGGAAGGCGGCGTTT
>gi|221734005|gb|CP000633.1|:1463198-1463366 Agrobacterium vitis S4 chromosome 1, complete sequence-taxID:311402
AAAAACTGACGAATAACAGGTTTAACCAATACCCCATGGTGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTTGGTCGGCAGGTGTGCGATTATCAAGCGGTTCCTCGTGCCGTTATTGCATGCCCGCCGACCCCCATTCCAACGCCGCTTCCCAACGCCGCTTCCT
>gi|47118328|dbj|BA000012.4|:c686074-685909 Mesorhizobium loti MAFF303099 DNA, complete genome-taxID:266835
GGGTAGATAGCCGGCTCGATCCCTAGAAATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCCGTGGGGTCGGCCGGCCGGCGCTGGCACATAGTGGCCTCCTCGTACCGCTGCCAAACGCCGACCGGCCCCCTTCTTTCAAACAGAACATCAGAACTTCG
>gi|744799323|gb|CP007641.1|:1652434-1652598 Rhizobium etli bv. phaseoli str. IE4803, complete genome-taxID:1432049
GAGAAGAGCTCCCGAAGAGGAGCTGTCCATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTTGGTCGGCTGGTAGGCAAGTCATAACGGTTCCTCGTGCCGTTTTGCATGCTGGCCGACCCCCTTTCAGGAAAACGCCGTCACTTCCCGAAG
>gi|459645537|gb|CP004140.1|:1411680-1411846 Sinorhizobium meliloti 2011, complete genome-taxID:1286640
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|440036399|gb|CP004015.1|:1451635-1451802 Rhizobium tropici CIAT 899, complete genome-taxID:698761
ATACAGACAACCCGTTTGGGTATCCGAGATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGTTGGCAGGCAGAAGATAACGGTTCCTCGTGCCGTTTTGCAGGCCAGCCGGCCCCCATTCAAAACGCCGCTCTTCATTTCTGAAGGGC
>gi|589085422|gb|CP007236.1|:2283540-2283709 Ensifer adhaerens OV14 chromosome 1 sequence-taxID:1416753
GCGGGGGCATAGCTTCCATCAGCTTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGTTGGCTTTTGACACCTGCGGAATCCTCGTGCCGCGGTCAGTAGCCAGCCGACCCCCATTCAAAGCGCTGTTCCGGAAGGGACAGCGCTT
>gi|115254414|emb|AM236080.1|:1817991-1818155 Rhizobium leguminosarum bv. viciae chromosome complete genome, strain 3841-taxID:216596
GAGAAGCGCTCCCGTTGAGGAGCTGTCGATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTAGTAGGCAAGTTATAGCGGTTCCTCGTGCCGTTTTGCATGCTGGCCGACCCCCTTTCAAGAAAACGCCGCCACTTCCCGAAG
>gi|528176563|gb|CP005950.1|:1676418-1676582 Rhizobium etli bv. mimosae str. Mim1, complete genome-taxID:1328306
AAGAAGCGCTCCCGCAGAGGAGCTGTCGATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTAGTAGGCAAGTCATAACGGTTCCTCGTGCCGTTTTGCATGCTGGCCGACCCCCTTTCAAGAAAACGCCGCCACTTCCGGAAG
>gi|86279771|gb|CP000133.1|:1718306-1718470 Rhizobium etli CFN 42, complete genome-taxID:347834
AAGAAGCGCTCCCGCAGAGGAGCTGTCGATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTAGTAGGCAAGTCATAACGGTTCCTCGTGCCGTTTTGCATGCTGGCCGACCCCCTTTCAAGAAAACGCCGCCACTTCCGGAAG
>gi|659659325|emb|HG938355.1|:1161239-1161408 Neorhizobium galegae, complete genome-taxID:1028801
GAAGATAACGTTCCCGAAAGGGACGCCGATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGACCGGCAGGCATACCAAAGCGGTTCCTCGTGCCGTGATTGCAGGCTGGTCGACCCCCATTTGAAAGCGCCGCTTCCAGCCTCTGGAGCGG
>gi|154158043|gb|CP000781.1|:4276606-4276771 Xanthobacter autotrophicus Py2, complete genome-taxID:78245
GGCACCGCCAGTCCCGCCATCAGGACAACCCTGCGGAGTGCTCAGGTCCGCCGCATCTCCTGGGTCCGTGGGGTTTGGCCGGTGGGTGAGCTTGCGGGAGGCCTCCCCGCTTTCTCCCCACCGGCCAGCCTATCTTCCGCAGACGATCACACCCCATTGGAAGCGC
>gi|822663067|gb|CP011479.1|:c2410409-2410246 Hoeflea sp. IMCC20628, complete genome-taxID:1620421
GGCAGGCTATAATTGTGAAAATTCTCCGATACCCCATGATGTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTGGCCGGTCAAGACCAAGTGCAATGTGGTATCCTCGTTCCACGCCTTTGTCCTGACCGGCCTTCAATACAAAAAACCCGCGTCCGGAAGGAG
>gi|190694918|gb|CP001074.1|:1700095-1700259 Rhizobium etli CIAT 652, complete genome-taxID:491916
AGAAGCGCTCCCGTAGAGGAGCTGTCCGATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGTAGGCAAGTCATAACGGTTCCTCGTGCCGTTTTGCATGCTGGCCGACCCCCTTTCAGGAAAACGCCGTCACTTCCCGAAG
>gi|584450787|emb|HG916852.1|:1652505-1652675 Rhizobium sp. LPU83 main chrosome complete genome-taxID:348824
GATAAGTACTCCCTGTGAGGAGTCCGGGATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGTTCGCAACATTAAGCGGTTCCTCGTGCCGCGTTGCTTGCCGGTCGACCCCCTTTCGAGTAAACGCCGTCCTTTCCGCATTTTCAGG
>gi|159139455|gb|AE007869.2|:1288558-1288722 Agrobacterium tumefaciens str. C58 circular chromosome, complete sequence-taxID:176299
CGTCAGGGGCTGGTATTGCGTAGTTTGAATGCCCCATGATGCTCAGGTCCGCCGCATCTCCTGAATCGTGGGGTCGGTCGGCTGACGATGTCCGAATCGGTTCCTCGTGCCGTAATCACATCGTTGGCCGACCGCCTTCTTCCCGAAAAAGCCTGTTGGTGGCGT
>gi|325059306|gb|CP002248.1|:1228817-1228981 Agrobacterium sp. H13-3 circular chromosome, complete sequence-taxID:861208
CGTCAGGGGCTGGTATTGCGTAGTTTGAATGCCCCATGATGCTCAGGTCCGCCGCATCTCCTGGATCGTGGGGTCGGTCGGCTGACGATGTCCGAATCGGTTCCTCGTGCCGTGATCACATCGTTAGCCGACCGCCTTATCTCCGAAAATATTCTGTGCTTGTGC
>gi|659653153|emb|HG938353.1|:1197463-1197632 Neorhizobium galegae, complete genome-taxID:1028800
GAAGATAACGTTCCCGAAAGGGACGCCGATACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGACTGGCAGGCATACCAAAGCGGTTCCTCGTGCCGTGATTGCAGGCTGGTCGACCCCCATTTGAAAGCGCCGCTTCCAGGCTTCTGGAGCG

Taxonomic tree

The taxonomic tree illustrates the outcome of the GLASSgo result.
You can Each taxonomic name has a specific value, which describes the number of summarized GLASSgo hits. These values are also used for scaling the corresponding nodes.

Job resubmission

Use the following button if you want to resubmit the job with altered input or parameterization:
Feeds the job parameters to the input page to resubmit the job.

de.NBI usability assessment

Please support us by filling this short quality survey for evaluating this de.NBI service.
Results are computed with GLASSgo version 1.4.2