Input and runtime details for job 6576753 (precomputed example)

Sequence Parameters

	RNA-1		GCCACUGCUUUUCUUUGAUGUCCCCAUUUUGUGGAGCCCAUCAACCCCGCCAUUUCGGUUCAAGGUUGGUGGGUUUUUU
	Index first position of RNA-1		1
	RNA-2		TCATGAAAGATAGTACTGTCGCCGCGTCTAAAATGCGCAAACGTGAACGCAATCGATTACGTAAATGATAGATATGTGAAACAAGACATATTTTTGTGAGCAATGATTTTTATAATAGGCTCCGCAGAAACACGAAATATTTAGAAACGCAAATTGCGTTCTTTTCACTCCCGCAAGGGATTTCAAACAGTGGCATACATATGAAAAAAACTTTACTCGCAGTCAGCGCAGCGCTGGCGCTCACCTCATCTTTTACTGCTAACGCAGCAGAAAATGATCAGCCGCAGTATTTGTCCGACT
	Index first position of RNA-2		-200

Mutation Parameters

	Mutation candidates		base pairs from mfe interaction only
	Ignore AU base pairs		no
	Ignore GU base pairs		no
	Ignore GC base pairs		no
	Ignore lonely base pairs		yes
	Ignore helix ends		yes
	Ignore helix ends of mfe		no
	Mutations to generate		flip (e.g. GC to CG)

Evaluation Parameters

	Classification combination		mfeCover + E
	Sorting within final classes		minDeltaE

IntaRNA Parameters

	Max. interaction length		not provided
	Max. absolute energy of an interaction		0
	No lonely base pairs		yes
	No GU at helix ends		yes
	Min. number of basepairs in seed		6
	Max. Number of mismatches in seed		0
	Maximal energy		0
	Minimal unpaired probability (per RNA)		0
	Seed position (RNA-1)		not provided
	Seed position (RNA-2)		not provided
	Ignore seeds with GU base pairs		no
	Ignore seeds with GU ends		yes
	Temperature for energy computation		37.0
	Access. RNA-1: folding window size		150
	Access. RNA-1: max. basepair distance		100
	Access. RNA-2: folding window size		150
	Access. RNA-2: max. basepair distance		100
	Energy parameter set (Vienna package)		Turner model, 2004

Job ID 6576753 (server version trunk)

	Job Submitted & Queued		@ Thu Feb 06 15:34:59 CET 2020
	CopomuS Started		@ Thu Feb 06 15:36:29 CET 2020
	CopomuS Finished & Post-Processing		@ Thu Feb 06 15:36:53 CET 2020
	Post-Processing Finished		@ Thu Feb 06 15:36:53 CET 2020
	Job Completed		@ Thu Feb 06 15:36:55 CET 2020

DIRECT ACCESS: http://rna.informatik.uni-freiburg.de/RetrieveResults.jsp?jobID=6576753&toolName=CopomuS ( 30 days expiry )

Description of the job

Verification of RybB-tsx interaction in Salmonella by Papenfort et al. (2010) was originally using C2G:G-8C. (note, here we use tsx sequence = genomic region [-200,+100] around start codon)

Verification of RybB-tsx interaction in Salmonella by Papenfort et al. (2010) was originally using C2G&G-8C. (note, here we use tsx sequence = genomic region [-200,+100] around start codon)

Output download complete results [zip]

Downloadable files

CopomuS result table:

[csv]

Identified and ranked mutation candidates

Show rows: 1-15 16-16 all

Sort by selecting a column name.

mutation encoding	rank	idx(1)	idx(2)	ww	mm	mfeCover (ww+mm)	E(ww\|mm)+x <E(wm\|mw)	mfe(ww)	mfe(wm)	mfe(mw)	mfe(mm)
C2G&G-8C	1	-8	2	CG	GC	1	1	-15.57	-6.38	-6.8	-16.05
U6A&A-12U	2	-12	6	UA	AU	1	1	-15.57	-4.94	-2.49	-12.82
C3G&G-9C	3	-9	3	CG	GC	1	1	-15.57	-8.32	-9.29	-16.04
C23G&G-23C	4	-23	23	CG	GC	1	1	-15.57	-11.51	-12.04	-18.48
U16A&A-16U	5	-16	16	UA	AU	1	1	-15.57	-11.47	-12.15	-15.85
U15A&A-15U	6	-15	15	UA	AU	1	1	-15.57	-12.59	-12.66	-15.38
A4U&U-10A	7	-10	4	AU	UA	1	1	-15.57	-12.93	-7.4	-17.23
G17C&C-17G	8	-17	17	GC	CG	1	1	-15.57	-10.1	-12.04	-14.55
C5G&G-11C	9	-11	5	CG	GC	1	1	-15.57	-8.38	-13.17	-17.3
C22G&G-22C	10	-22	22	CG	GC	1	1	-15.57	-13.57	-12.43	-18.93
U30A&A-26U	11	-26	30	UA	AU	1	1	-15.57	-12.56	-10.09	-13.88
U21A&A-21U	12	-21	21	UA	AU	1	1	-15.57	-14.4	-12.1	-16.53
U29A&A-25U	13	-25	29	UA	AU	1	1	-15.57	-14.45	-13.43	-16.31
G31C&C-27G	14	-27	31	GC	CG	1	0	-15.57	-14.59	-13.15	-16.73
G33C&C-29G	15	-29	33	GC	CG	1	0	-15.57	-14.97	-13.17	-19.45

Rows: 1-15 16-16 all

Sequences for selected mutation

Predicted mfe(ww) interaction of RNA1-RNA2

RNA-2
           -30                                -7
             |                                |
5'-UCA...ACUC      ----    UU     ------       AUAC...ACU-3'
             CCGCAA    GGGA  UCAAA      CAGUGGC
             ++++++    ||||  |||||      +++++++
             GGUGUU    CCCU  AGUUU      GUCACCG
3'-UUU...CCGA      UUAC    GU     CUUUUC       -5'
             |                                |
            34                                1
RNA-1

interaction energy = -15.57 kcal/mol

Job resubmission

Use the following button if you want to resubmit the job with altered input or parameterization:

usability assessment

Please support us by filling this short quality survey for evaluating this

service.

When using CopomuS please cite :

Martin Raden, Fabio Gutmann, Michael Uhl, and Rolf Backofen
CopomuS - ranking compensatory mutations to guide RNA-RNA interaction
International Journal of Molecular Sciences, 21(11),3852, 2020.
Martin Mann, Patrick R. Wright, and Rolf Backofen
IntaRNA 2.0: enhanced and customizable prediction of RNA–RNA interactions
Nucleic Acids Research, 2017, 45 (W1), W435–W439.
Martin Raden, Syed M Ali, Omer S Alkhnbashi, Anke Busch, Fabrizio Costa, Jason A Davis, Florian Eggenhofer, Rick Gelhausen, Jens Georg, Steffen Heyne, Michael Hiller, Kousik Kundu, Robert Kleinkauf, Steffen C Lott, Mostafa M Mohamed, Alexander Mattheis, Milad Miladi, Andreas S Richter, Sebastian Will, Joachim Wolff, Patrick R Wright, and Rolf Backofen
Freiburg RNA tools: a central online resource for RNA-focused research and teaching
Nucleic Acids Research, 46(W1), W25-W29, 2018.

Results are computed with CopomuS version dev using IntaRNA 3.1.5

Main Menu

Freiburg RNA Tools

Interaction Prediction

Seq-Str Alignment

CRISPR

Sequence Design

Splicing

SNP & Mutation

Classification

Gene set extension

MoDPepInt Server

CPSP-Tools Server

Galaxy-FR

CMV server

Teaching