Use the following button if you want to resubmit the job with
			altered input or parameterization:
		
		
	Input and runtime details for job 3195732 (precomputed example)
Input Parameters
|  Sequence(s) | [.fa] | ||
|  Sequence type | Single Genome DNA (FASTA format) | 
Genome information
|  DNA sequence completeness | complete | 
Parameters concerning CRISPR arrays
Parameters concerning Cas genes
|  ML model to run | combination of both | ||
|  Select the classifiers | ERT | ||
|  Select the regressors | ERT | ||
|  Max. number of contiguous gaps in a cassette | 2 | 
Parameters for CRISPR repeat input
|  Hit sensitivity (e-value threshold) | 0.01 | 
Parameters for Virus DNA/RNA input
|  Hit sensitivity (e-value threshold) | 0.000001 | 
Job ID 3195732 (server version trunk)
|  | Job Submitted & Queued | @ Fri Dec 18 07:37:00 CET 2020 | |
|  | CRISPRloci Started | @ Fri Dec 18 07:37:09 CET 2020 | |
|  | CRISPRloci Finished & Post-Processing | @ Fri Dec 18 07:50:33 CET 2020 | |
|  | Job Completed | @ Fri Dec 18 07:50:55 CET 2020 | 
 DIRECT ACCESS: https://rna.informatik.uni-freiburg.de/RetrieveResults.jsp?jobID=3195732&toolName=CRISPRloci ( 30 days expiry )
Description of the job
Synechocystis sp. PCC 6803 plasmid pSYSA (NC_005230)
CRISPR Array Summary
	
		
			Sort by selecting a column name.
		
		
			[Download Table Data]
		
		
		
		
		
		
		
		
		
		
	
 
		
	
       
      
    | ID | Start | End | Length | Consensus repeat | Repeat Length | Average Spacer Length | Number of spacers | Strand | Category | subtype | 
|---|---|---|---|---|---|---|---|---|---|---|
| CRISPR1 | 16310 | 19901 | 3592 | GTTTCAGTCCCGATCGCCGGGATTAGTAGAAGGAAAG | 37 | 35 | 49 | Reversed | Bona-fide | I-D | 
| CRISPR2 | 68499 | 72778 | 4280 | GTTTCAGTCCCCTGACGGGGAAAAGAGGGTGTTGAAC | 37 | 38 | 56 | Reversed | Bona-fide | III-D | 
| CRISPR3 | 90105 | 92958 | 2854 | GTCTCCACTCGTAGGAGAAATTAATTGATTGGAAAC | 36 | 38 | 38 | Forward | Bona-fide | III-B | 
CRISPR Details for selection from above
Summary of Self-targeting
	
		
			Sort by selecting a column name.
		
		
			[Download Table Data]
		
		
		
		
		
		
		
		
		
		
	
 
		
	
    
	
	
	
	
	| #mismatches | Spacer.Len | SpacerID | ArrayID | Spacer.Start.Alin | Spacer.End.Align | Start-Area.selftargets | End-Area.selftargets | Category | Detail | 
|---|---|---|---|---|---|---|---|---|---|
| 17 | 38 | S25 | Array1 | 31 | 2 | 38671 | 38700 | ProphageRegion | ProphageRegion | 
| 18 | 36 | S26 | Array1 | 22 | 1 | 35435 | 35456 | ProphageRegion | ProphageRegion | 
| 24 | 39 | S24 | Array1 | 28 | 10 | 37975 | 37993 | ProphageRegion | ProphageRegion | 
| 18 | 35 | S1 | Array2 | 33 | 12 | 34207 | 34228 | ProphageRegion | ProphageRegion | 
| 18 | 41 | S36 | Array2 | 37 | 7 | 33139 | 33168 | ProphageRegion | ProphageRegion | 
| 22 | 43 | S39 | Array2 | 32 | 6 | 31974 | 32000 | ProphageRegion | ProphageRegion | 
| 28 | 41 | S12 | Array2 | 18 | 5 | 30803 | 30816 | ProphageRegion | ProphageRegion | 
| 29 | 46 | S32 | Array2 | 27 | 6 | 36609 | 36630 | ProphageRegion | ProphageRegion | 
| 10 | 37 | S1 | Array3 | 36 | 1 | 34555 | 34590 | ProphageRegion | ProphageRegion | 
| 18 | 37 | S10 | Array3 | 26 | 3 | 33312 | 33335 | ProphageRegion | ProphageRegion | 
| 18 | 40 | S5 | Array3 | 34 | 4 | 33904 | 33934 | ProphageRegion | ProphageRegion | 
| 21 | 38 | S9 | Array3 | 29 | 7 | 37695 | 37717 | ProphageRegion | ProphageRegion | 
| 9 | 32 | S1 | Array_1 | 31 | 1 | 50583 | 50613 | GenomicRegion | GenomicRegion | 
| 12 | 33 | S2 | Array_1 | 32 | 1 | 28663 | 28694 | GenomicRegion | GenomicRegion | 
| 14 | 35 | S23 | Array_1 | 34 | 6 | 52165 | 52193 | CasgeneRegion | csx1_III-D(Prot70) | 
| 14 | 35 | S3 | Array_1 | 26 | 2 | 78970 | 78994 | GenomicRegion | GenomicRegion | 
| 14 | 36 | S28 | Array_1 | 33 | 3 | 12657 | 12687 | CasgeneRegion | csc1_I-D(Prot13) | 
| 14 | 38 | S45 | Array_1 | 36 | 2 | 53132 | 53166 | CasgeneRegion | csm6_III-D(Prot71) | 
| 16 | 37 | S12 | Array_1 | 31 | 2 | 30258 | 30287 | GenomicRegion | GenomicRegion | 
| 17 | 34 | S15 | Array_1 | 33 | 12 | 3317 | 3338 | GenomicRegion | GenomicRegion | 
| 17 | 34 | S47 | Array_1 | 25 | 4 | 100467 | 100488 | GenomicRegion | GenomicRegion | 
| 17 | 34 | S7 | Array_1 | 23 | 2 | 76778 | 76799 | GenomicRegion | GenomicRegion | 
| 17 | 35 | S22 | Array_1 | 24 | 1 | 62145 | 62168 | CasgeneRegion | cas10_III-D(Prot76) | 
| 17 | 36 | S10 | Array_1 | 34 | 10 | 80708 | 80732 | CasgeneRegion | cmr6_III-B(Prot93) | 
| 17 | 36 | S27 | Array_1 | 33 | 9 | 29126 | 29150 | GenomicRegion | GenomicRegion | 
| 17 | 36 | S31 | Array_1 | 30 | 6 | 44999 | 45023 | GenomicRegion | GenomicRegion | 
| 17 | 36 | S32 | Array_1 | 25 | 1 | 66112 | 66136 | CasgeneRegion | cas2_III-D(Prot81) | 
| 17 | 36 | S9 | Array_1 | 34 | 10 | 80708 | 80732 | CasgeneRegion | cmr6_III-B(Prot93) | 
| 18 | 36 | S36 | Array_1 | 34 | 13 | 58558 | 58579 | CasgeneRegion | csm3_III-D(Prot75) | 
| 18 | 36 | S49 | Array_1 | 27 | 7 | 85650 | 85670 | CasgeneRegion | cas10_III-B(Prot98) | 
| 18 | 37 | S6 | Array_1 | 35 | 10 | 96811 | 96836 | GenomicRegion | GenomicRegion | 
| 18 | 38 | S18 | Array_1 | 31 | 5 | 48144 | 48170 | GenomicRegion | GenomicRegion | 
| 18 | 38 | S20 | Array_1 | 31 | 5 | 48144 | 48170 | GenomicRegion | GenomicRegion | 
| 18 | 38 | S21 | Array_1 | 28 | 1 | 97100 | 97127 | GenomicRegion | GenomicRegion | 
| 18 | 38 | S48 | Array_1 | 36 | 11 | 21290 | 21315 | GenomicRegion | GenomicRegion | 
| 18 | 38 | S4 | Array_1 | 28 | 1 | 12992 | 13019 | CasgeneRegion | csc1_I-D(Prot13) | 
| 18 | 38 | S5 | Array_1 | 29 | 2 | 62575 | 62602 | CasgeneRegion | cas10_III-D(Prot76) | 
| 19 | 36 | S39 | Array_1 | 31 | 9 | 101207 | 101229 | GenomicRegion | GenomicRegion | 
| 19 | 36 | S40 | Array_1 | 31 | 9 | 101207 | 101229 | GenomicRegion | GenomicRegion | 
| 19 | 37 | S38 | Array_1 | 33 | 11 | 73712 | 73734 | GenomicRegion | GenomicRegion | 
| 19 | 37 | S42 | Array_1 | 36 | 15 | 6818 | 6839 | CasgeneRegion | cas3_I-D(Prot10) | 
| 20 | 36 | S16 | Array_1 | 23 | 4 | 14029 | 14048 | CasgeneRegion | cas6_I-D(Prot14) | 
| 20 | 36 | S41 | Array_1 | 32 | 13 | 25314 | 25333 | GenomicRegion | GenomicRegion | 
| 20 | 37 | S37 | Array_1 | 25 | 5 | 93770 | 93790 | GenomicRegion | GenomicRegion | 
| 21 | 35 | S29 | Array_1 | 34 | 19 | 50558 | 50573 | GenomicRegion | GenomicRegion | 
| 21 | 35 | S35 | Array_1 | 25 | 9 | 75204 | 75220 | GenomicRegion | GenomicRegion | 
| 21 | 37 | S8 | Array_1 | 32 | 15 | 8323 | 8340 | CasgeneRegion | cas3_I-D(Prot10) | 
| 21 | 38 | S46 | Array_1 | 24 | 1 | 43610 | 43633 | GenomicRegion | GenomicRegion | 
| 22 | 35 | S11 | Array_1 | 18 | 5 | 27874 | 27887 | GenomicRegion | GenomicRegion | 
| 22 | 36 | S43 | Array_1 | 32 | 18 | 42967 | 42981 | GenomicRegion | GenomicRegion | 
| 22 | 40 | S44 | Array_1 | 31 | 5 | 79806 | 79832 | GenomicRegion | GenomicRegion | 
| 23 | 42 | S17 | Array_1 | 27 | 3 | 38824 | 38848 | GenomicRegion | GenomicRegion | 
| 23 | 42 | S19 | Array_1 | 27 | 3 | 38824 | 38848 | GenomicRegion | GenomicRegion | 
| 25 | 37 | S34 | Array_1 | 27 | 15 | 98193 | 98205 | GenomicRegion | GenomicRegion | 
| 12 | 41 | S27 | Array_2 | 40 | 2 | 8298 | 8334 | CasgeneRegion | cas3_I-D(Prot10) | 
| 13 | 36 | S15 | Array_2 | 34 | 2 | 57426 | 57458 | CasgeneRegion | csm3_III-D(Prot74) | 
| 14 | 37 | S53 | Array_2 | 36 | 6 | 9031 | 9061 | CasgeneRegion | cas10d_I-D(Prot11) | 
| 16 | 36 | S23 | Array_2 | 30 | 2 | 61912 | 61940 | CasgeneRegion | cas10_III-D(Prot76) | 
| 16 | 38 | S10 | Array_2 | 35 | 8 | 7634 | 7661 | CasgeneRegion | cas3_I-D(Prot10) | 
| 16 | 38 | S13 | Array_2 | 32 | 2 | 11366 | 11396 | CasgeneRegion | cas10d_I-D(Prot11) | 
| 18 | 35 | S3 | Array_2 | 22 | 2 | 14491 | 14511 | CasgeneRegion | cas4_I-D(Prot15) | 
| 18 | 36 | S8 | Array_2 | 34 | 11 | 88701 | 88724 | CasgeneRegion | cas1_III-B(Prot100) | 
| 18 | 37 | S24 | Array_2 | 36 | 10 | 94163 | 94189 | GenomicRegion | GenomicRegion | 
| 19 | 36 | S33 | Array_2 | 23 | 1 | 85891 | 85913 | CasgeneRegion | cas10_III-B(Prot98) | 
| 19 | 37 | S18 | Array_2 | 32 | 8 | 50276 | 50300 | GenomicRegion | GenomicRegion | 
| 19 | 37 | S20 | Array_2 | 32 | 8 | 50276 | 50300 | GenomicRegion | GenomicRegion | 
| 19 | 39 | S44 | Array_2 | 28 | 3 | 84194 | 84219 | CasgeneRegion | cmr3_III-B(Prot97) | 
| 19 | 41 | S28 | Array_2 | 39 | 8 | 73156 | 73187 | GenomicRegion | GenomicRegion | 
| 19 | 43 | S54 | Array_2 | 41 | 6 | 8225 | 8260 | CasgeneRegion | cas3_I-D(Prot10) | 
| 20 | 35 | S26 | Array_2 | 32 | 14 | 5789 | 5807 | CasgeneRegion | wyl_I-D(Prot9) | 
| 20 | 38 | S29 | Array_2 | 28 | 5 | 43284 | 43307 | GenomicRegion | GenomicRegion | 
| 20 | 46 | S4 | Array_2 | 43 | 6 | 66561 | 66598 | GenomicRegion | GenomicRegion | 
| 21 | 36 | S37 | Array_2 | 33 | 15 | 50333 | 50351 | GenomicRegion | GenomicRegion | 
| 21 | 37 | S14 | Array_2 | 31 | 11 | 53605 | 53625 | CasgeneRegion | csm6_III-D(Prot71) | 
| 21 | 37 | S22 | Array_2 | 19 | 1 | 52095 | 52113 | CasgeneRegion | csx1_III-D(Prot70) | 
| 21 | 38 | S35 | Array_2 | 34 | 13 | 9243 | 9264 | CasgeneRegion | cas10d_I-D(Prot11) | 
| 21 | 39 | S31 | Array_2 | 34 | 13 | 67471 | 67492 | GenomicRegion | GenomicRegion | 
| 22 | 37 | S52 | Array_2 | 23 | 5 | 9838 | 9856 | CasgeneRegion | cas10d_I-D(Prot11) | 
| 22 | 40 | S25 | Array_2 | 33 | 11 | 29530 | 29552 | GenomicRegion | GenomicRegion | 
| 22 | 40 | S45 | Array_2 | 39 | 13 | 26750 | 26776 | GenomicRegion | GenomicRegion | 
| 22 | 41 | S17 | Array_2 | 38 | 14 | 103071 | 103095 | GenomicRegion | GenomicRegion | 
| 22 | 41 | S19 | Array_2 | 38 | 14 | 103071 | 103095 | GenomicRegion | GenomicRegion | 
| 23 | 41 | S40 | Array_2 | 40 | 16 | 54234 | 54258 | CasgeneRegion | csm3_III-D(Prot72) | 
| 24 | 37 | S56 | Array_2 | 21 | 8 | 67892 | 67905 | GenomicRegion | GenomicRegion | 
| 24 | 39 | S41 | Array_2 | 37 | 19 | 95598 | 95616 | GenomicRegion | GenomicRegion | 
| 24 | 45 | S46 | Array_2 | 35 | 5 | 89646 | 89676 | CasgeneRegion | cas2_III-B(Prot101) | 
| 25 | 40 | S21 | Array_2 | 19 | 1 | 75183 | 75201 | GenomicRegion | GenomicRegion | 
| 25 | 46 | S7 | Array_2 | 39 | 12 | 85489 | 85516 | CasgeneRegion | cas10_III-B(Prot98) | 
| 26 | 40 | S48 | Array_2 | 29 | 14 | 78563 | 78578 | GenomicRegion | GenomicRegion | 
| 26 | 40 | S50 | Array_2 | 29 | 14 | 78563 | 78578 | GenomicRegion | GenomicRegion | 
| 26 | 42 | S9 | Array_2 | 18 | 1 | 86963 | 86980 | CasgeneRegion | cas10_III-B(Prot98) | 
| 27 | 40 | S30 | Array_2 | 30 | 16 | 9297 | 9311 | CasgeneRegion | cas10d_I-D(Prot11) | 
| 27 | 41 | S5 | Array_2 | 22 | 7 | 82523 | 82538 | CasgeneRegion | cmr5_III-B(Prot94) | 
| 27 | 42 | S43 | Array_2 | 24 | 8 | 28458 | 28474 | GenomicRegion | GenomicRegion | 
| 27 | 47 | S2 | Array_2 | 30 | 5 | 39973 | 39998 | GenomicRegion | GenomicRegion | 
| 31 | 44 | S11 | Array_2 | 13 | 1 | 67759 | 67771 | GenomicRegion | GenomicRegion | 
| 31 | 44 | S38 | Array_2 | 21 | 8 | 24892 | 24905 | GenomicRegion | GenomicRegion | 
| 14 | 36 | S22 | Array_3 | 32 | 1 | 100595 | 100626 | GenomicRegion | GenomicRegion | 
| 15 | 36 | S16 | Array_3 | 33 | 4 | 14772 | 14801 | CasgeneRegion | cas4_I-D(Prot15) | 
| 16 | 37 | S29 | Array_3 | 34 | 5 | 74194 | 74223 | GenomicRegion | GenomicRegion | 
| 16 | 38 | S11 | Array_3 | 32 | 1 | 7811 | 7842 | CasgeneRegion | cas3_I-D(Prot10) | 
| 16 | 38 | S18 | Array_3 | 32 | 1 | 60246 | 60277 | CasgeneRegion | csm3_III-D(Prot75) | 
| 16 | 38 | S35 | Array_3 | 37 | 4 | 30557 | 30590 | GenomicRegion | GenomicRegion | 
| 16 | 40 | S17 | Array_3 | 36 | 5 | 12218 | 12249 | CasgeneRegion | csc2_I-D(Prot12) | 
| 16 | 40 | S25 | Array_3 | 38 | 4 | 8040 | 8074 | CasgeneRegion | cas3_I-D(Prot10) | 
| 17 | 36 | S12 | Array_3 | 30 | 5 | 11024 | 11049 | CasgeneRegion | cas10d_I-D(Prot11) | 
| 17 | 37 | S6 | Array_3 | 28 | 1 | 99613 | 99640 | GenomicRegion | GenomicRegion | 
| 18 | 37 | S14 | Array_3 | 31 | 7 | 4659 | 4683 | GenomicRegion | GenomicRegion | 
| 18 | 37 | S4 | Array_3 | 28 | 2 | 84076 | 84102 | CasgeneRegion | cmr3_III-B(Prot97) | 
| 19 | 38 | S8 | Array_3 | 36 | 11 | 7261 | 7286 | CasgeneRegion | cas3_I-D(Prot10) | 
| 20 | 40 | S21 | Array_3 | 39 | 15 | 82816 | 82840 | CasgeneRegion | cmr4_III-B(Prot95) | 
| 20 | 41 | S38 | Array_3 | 32 | 3 | 20950 | 20979 | GenomicRegion | GenomicRegion | 
| 21 | 37 | S13 | Array_3 | 36 | 17 | 26912 | 26931 | GenomicRegion | GenomicRegion | 
| 21 | 37 | S2 | Array_3 | 25 | 6 | 47533 | 47552 | GenomicRegion | GenomicRegion | 
| 21 | 42 | S15 | Array_3 | 36 | 9 | 222 | 249 | GenomicRegion | GenomicRegion | 
| 22 | 36 | S33 | Array_3 | 35 | 19 | 97246 | 97262 | GenomicRegion | GenomicRegion | 
| 22 | 38 | S23 | Array_3 | 32 | 12 | 29362 | 29382 | GenomicRegion | GenomicRegion | 
| 22 | 40 | S26 | Array_3 | 26 | 5 | 80454 | 80475 | CasgeneRegion | cmr6_III-B(Prot93) | 
| 23 | 40 | S28 | Array_3 | 25 | 3 | 2882 | 2904 | GenomicRegion | GenomicRegion | 
| 24 | 40 | S36 | Array_3 | 39 | 20 | 77249 | 77268 | GenomicRegion | GenomicRegion | 
| 24 | 41 | S24 | Array_3 | 31 | 10 | 45779 | 45800 | GenomicRegion | GenomicRegion | 
| 24 | 43 | S31 | Array_3 | 30 | 6 | 86204 | 86228 | CasgeneRegion | cas10_III-B(Prot98) | 
| 24 | 48 | S34 | Array_3 | 36 | 2 | 49364 | 49398 | GenomicRegion | GenomicRegion | 
| 25 | 39 | S19 | Array_3 | 18 | 4 | 20508 | 20522 | GenomicRegion | GenomicRegion | 
| 25 | 47 | S27 | Array_3 | 46 | 12 | 74443 | 74477 | GenomicRegion | GenomicRegion | 
| 27 | 42 | S32 | Array_3 | 37 | 19 | 89961 | 89979 | GenomicRegion | GenomicRegion | 
CAS Protein Classification
	
		
			Sort by selecting a column name.
		
		
			[Download Table Data]
		
		
		
		
		
		
		
		
		
		
	
 
		
	
      
    | ID | Name | Subtype | Module | Cassette | Strand | Start | End | Length | 
|---|---|---|---|---|---|---|---|---|
| Prot9 | wyl | I-D | interference | 2 | minus | 5340 | 6284 | 315 | 
| Prot10 | cas3 | I-D | interference | 2 | plus | 6349 | 8517 | 723 | 
| Prot11 | cas10d | I-D | interference | 2 | plus | 8531 | 11458 | 976 | 
| Prot12 | csc2 | I-D | interference | 2 | plus | 11524 | 12513 | 330 | 
| Prot13 | csc1 | I-D | interference | 2 | plus | 12674 | 13438 | 255 | 
| Prot14 | cas6 | I-D | processing | 2 | plus | 13441 | 14229 | 263 | 
| Prot15 | cas4 | I-D | adaptation | 2 | plus | 14222 | 14794 | 191 | 
| Prot16 | cas1 | I-D | adaptation | 2 | plus | 14804 | 15781 | 326 | 
| Prot17 | cas2 | I-D | adaptation | 2 | plus | 15813 | 16097 | 95 | 
| Prot70 | csx1 | III-D | interference | 3 | plus | 51537 | 52805 | 423 | 
| Prot71 | csm6 | III-D | interference | 3 | minus | 52881 | 53996 | 372 | 
| Prot72 | csm3 | III-D | interference | 3 | minus | 54005 | 56392 | 796 | 
| Prot73 | csx19 | III-D | interference | 3 | minus | 56394 | 56954 | 187 | 
| Prot74 | csm3 | III-D | interference | 3 | minus | 56954 | 58522 | 523 | 
| Prot75 | csm3 | III-D | interference | 3 | minus | 58527 | 60902 | 792 | 
| Prot76 | cas10 | III-D | interference | 3 | minus | 60905 | 62581 | 559 | 
| Prot77 | cas6 | III-D | processing | 3 | plus | 62911 | 64011 | 367 | 
| Prot78 | csx18 | III-D | interference | 3 | minus | 64005 | 64319 | 105 | 
| Prot79 | unknown | III-D | potential_cas | 3 | minus | 64316 | 64690 | 125 | 
| Prot80 | cas1 | III-D | adaptation | 3 | plus | 64822 | 65832 | 337 | 
| Prot81 | cas2 | III-D | adaptation | 3 | plus | 65842 | 66123 | 94 | 
| Prot93 | cmr6 | III-B | interference | 1 | minus | 80203 | 82140 | 646 | 
| Prot94 | cmr5 | III-B | interference | 1 | minus | 82196 | 82591 | 132 | 
| Prot95 | cmr4 | III-B | interference | 1 | minus | 82630 | 83409 | 260 | 
| Prot96 | unknown | III-B | potential_cas | 1 | plus | 83501 | 83881 | 127 | 
| Prot97 | cmr3 | III-B | interference | 1 | minus | 83905 | 85017 | 371 | 
| Prot98 | cas10 | III-B | interference | 1 | minus | 85199 | 88138 | 980 | 
| Prot99 | unknown | III-B | potential_cas | 1 | minus | 88253 | 88546 | 98 | 
| Prot100 | cas1 | III-B | adaptation | 1 | plus | 88627 | 89616 | 330 | 
| Prot101 | cas2 | III-B | adaptation | 1 | plus | 89620 | 89898 | 93 | 
CAS Protein Sequence for selection from above
 To search for conserved domains within the protein, 
	    	copy and paste its sequence to the  
	    	CD-search of NCBI.
	    	
(It is not possible to auto-fill the CD-search input form without job submission.)
    (It is not possible to auto-fill the CD-search input form without job submission.)
Job resubmission
 usability assessment
 
		usability assessment
	When using CRISPRloci please cite :
- Omer S. Alkhnbashi, Alexander Mitrofanov, Robson Bonidia, Martin Raden, Van Dinh Tran, Florian Eggenhofer, Shiraz A. Shah, Ekrem ̈Öztürk, Victor A. Padilha, Danilo S. Sanches, Andre C.P.L.F. de Carvalho and Rolf Backofen
 CRISPRloci: comprehensive and accurate annotation of CRISPR–Cas systems
 Nucleic Acids Research, 2021.
- Alexander Mitrofanov, Omer S. Alkhnbashi, Sergey A. Shmakov, Kira S. Makarova, Eugene V. Koonin, and Rolf Backofen
 CRISPRidentify: identification of CRISPR arrays using machine learning approach
 Nucleic Acids Research, 49(4), e20, 2021.
- Victor A. Padilha, Omer S. Alkhnbashi, Van Dinh Tran, Shiraz A. Shah, Andre C.P.L. de Carvalho and Rolf Backofen
 Casboundary: automated definition of integral Cas cassettes
 Bioinformatics, 2021.
- Victor A. Padilha, Omer S. Alkhnbashi, Shiraz A. Shah,  Andre C.P.L.F. de Carvalho and Rolf Backofen
 CRISPRcasIdentifier: Machine learning for accurate identification and classification of CRISPR-Cas systems
 Gigascience, 9(6), 2020.
- Martin Raden, Syed M Ali, Omer S Alkhnbashi, Anke Busch, Fabrizio Costa, Jason A Davis, Florian Eggenhofer, Rick Gelhausen, Jens Georg, Steffen Heyne, Michael Hiller, Kousik Kundu, Robert Kleinkauf, Steffen C Lott, Mostafa M Mohamed, Alexander Mattheis, Milad Miladi, Andreas S Richter, Sebastian Will, Joachim Wolff, Patrick R Wright, and Rolf Backofen
 Freiburg RNA tools: a central online resource for RNA-focused research and teaching
 Nucleic Acids Research, 46(W1), W25-W29, 2018.
Results are computed with CRISPRloci version 1.1.0
		 
	
			
		 
			  
			 
 
		 
			