Freiburg RNA Tools
CopomuS - Results
BIF
IFF
CopomuS 6576753

Input and runtime details for job 6576753 (precomputed example)

Sequence Parameters

? RNA-1
GCCACUGCUUUUCUUUGAUGUCCCCAUUUUGUGGAGCCCAUCAACCCCGCCAUUUCGGUUCAAGGUUGGUGGGUUUUUU
? Index first position of RNA-11
? RNA-2
TCATGAAAGATAGTACTGTCGCCGCGTCTAAAATGCGCAAACGTGAACGCAATCGATTACGTAAATGATAGATATGTGAAACAAGACATATTTTTGTGAGCAATGATTTTTATAATAGGCTCCGCAGAAACACGAAATATTTAGAAACGCAAATTGCGTTCTTTTCACTCCCGCAAGGGATTTCAAACAGTGGCATACATATGAAAAAAACTTTACTCGCAGTCAGCGCAGCGCTGGCGCTCACCTCATCTTTTACTGCTAACGCAGCAGAAAATGATCAGCCGCAGTATTTGTCCGACT
? Index first position of RNA-2-200

Mutation Parameters

? Mutation candidates base pairs from mfe interaction only
? Ignore AU base pairsno
? Ignore GU base pairsno
? Ignore GC base pairsno
? Ignore lonely base pairsyes
? Ignore helix endsyes
? Ignore helix ends of mfeno
? Mutations to generate flip (e.g. GC to CG)

Evaluation Parameters

? Classification combination mfeCover + E
? Sorting within final classes minDeltaE

IntaRNA Parameters

? Max. interaction lengthnot provided
? Max. absolute energy of an interaction0
? No lonely base pairsyes
? No GU at helix endsyes
? Min. number of basepairs in seed6
? Max. Number of mismatches in seed0
? Maximal energy0
? Minimal unpaired probability (per RNA)0
? Seed position (RNA-1)not provided
? Seed position (RNA-2)not provided
? Ignore seeds with GU base pairsno
? Ignore seeds with GU endsyes
? Temperature for energy computation37.0
? Access. RNA-1: folding window size150
? Access. RNA-1: max. basepair distance100
? Access. RNA-2: folding window size150
? Access. RNA-2: max. basepair distance100
? Energy parameter set (Vienna package) Turner model, 2004

Job ID 6576753 (server version trunk)

?Job Submitted & Queued@ Thu Feb 06 15:34:59 CET 2020
?CopomuS Started@ Thu Feb 06 15:36:29 CET 2020
?CopomuS Finished & Post-Processing@ Thu Feb 06 15:36:53 CET 2020
?Post-Processing Finished@ Thu Feb 06 15:36:53 CET 2020
?Job Completed@ Thu Feb 06 15:36:55 CET 2020
 DIRECT ACCESS: https://rna.informatik.uni-freiburg.de/RetrieveResults.jsp?jobID=6576753&toolName=CopomuS ( 30 days expiry )

Description of the job

Verification of RybB-tsx interaction in Salmonella by Papenfort et al. (2010) was originally using C2G:G-8C. (note, here we use tsx sequence = genomic region [-200,+100] around start codon)

Verification of RybB-tsx interaction in Salmonella by Papenfort et al. (2010) was originally using C2G&G-8C. (note, here we use tsx sequence = genomic region [-200,+100] around start codon)

? Output download complete results [zip]

Downloadable files

[csv]

? Identified and ranked mutation candidates

Show rows: 1-15 16-16 all
Sort by selecting a column name.
mutation encoding rank idx(1) idx(2) ww mm mfeCover (ww+mm) E(ww|mm)+x <E(wm|mw) mfe(ww) mfe(wm) mfe(mw) mfe(mm)
G33C&C-29G 15 -29 33 GC CG 1 0 -15.57 -14.97 -13.17 -19.45
U32G&G-28U 16 -28 32 UG GU 1 0 -15.57 -13.09 -11.65 -12.61
G31C&C-27G 14 -27 31 GC CG 1 0 -15.57 -14.59 -13.15 -16.73
U30A&A-26U 11 -26 30 UA AU 1 1 -15.57 -12.56 -10.09 -13.88
U29A&A-25U 13 -25 29 UA AU 1 1 -15.57 -14.45 -13.43 -16.31
C23G&G-23C 4 -23 23 CG GC 1 1 -15.57 -11.51 -12.04 -18.48
C22G&G-22C 10 -22 22 CG GC 1 1 -15.57 -13.57 -12.43 -18.93
U21A&A-21U 12 -21 21 UA AU 1 1 -15.57 -14.4 -12.1 -16.53
G17C&C-17G 8 -17 17 GC CG 1 1 -15.57 -10.1 -12.04 -14.55
U16A&A-16U 5 -16 16 UA AU 1 1 -15.57 -11.47 -12.15 -15.85
U15A&A-15U 6 -15 15 UA AU 1 1 -15.57 -12.59 -12.66 -15.38
U6A&A-12U 2 -12 6 UA AU 1 1 -15.57 -4.94 -2.49 -12.82
C5G&G-11C 9 -11 5 CG GC 1 1 -15.57 -8.38 -13.17 -17.3
A4U&U-10A 7 -10 4 AU UA 1 1 -15.57 -12.93 -7.4 -17.23
C3G&G-9C 3 -9 3 CG GC 1 1 -15.57 -8.32 -9.29 -16.04
Rows: 1-15 16-16 all

Sequences for selected mutation


		

? Predicted mfe(ww) interaction of RNA1-RNA2

RNA-2
           -30                                -7
             |                                |
5'-UCA...ACUC      ----    UU     ------       AUAC...ACU-3'
             CCGCAA    GGGA  UCAAA      CAGUGGC
             ++++++    ||||  |||||      +++++++
             GGUGUU    CCCU  AGUUU      GUCACCG
3'-UUU...CCGA      UUAC    GU     CUUUUC       -5'
             |                                |
            34                                1
RNA-1

interaction energy = -15.57 kcal/mol

Job resubmission

Use the following button if you want to resubmit the job with altered input or parameterization:
Feeds the job parameters to the input page to resubmit the job.

de.NBI usability assessment

Please support us by filling this short quality survey for evaluating this de.NBI service.

When using CopomuS please cite :

Results are computed with CopomuS version dev using IntaRNA 3.1.5