Use the following button if you want to resubmit the job with
altered input or parameterization:
Input and runtime details for job 7495372 (precomputed example)
Constraints
Constraint
![]() | yes | ||
![]() | yes |
Energy
![]() | 37.0 |
AntaRNA
Output
![]() | 10 |
Job ID 7495372 (server version 4.0.0)
![]() | Job Submitted & Queued | @ Fri Jun 19 13:30:44 CEST 2015 | |
![]() | AntaRNA Started | @ Fri Jun 19 13:30:52 CEST 2015 | |
![]() | AntaRNA Finished & Post-Processing | @ Fri Jun 19 13:31:09 CEST 2015 | |
![]() | Post-Processing Finished | @ Fri Jun 19 13:31:10 CEST 2015 | |
![]() | Job Completed | @ Fri Jun 19 13:31:11 CEST 2015 |
DIRECT ACCESS: https://rna.informatik.uni-freiburg.de/RetrieveResults.jsp?jobID=7495372&toolName=AntaRNA ( 30 days expiry )
Description of the job
Design sequences for the crossing pseudoknot structures PKB298 with low GC-content.
Output
download complete results
[zip]
Designed sequences
Name | Sequence & mfe | GC% | dStr% | dSeq% | dGC% |
---|---|---|---|---|---|
Target | NGNNGNNNNNNNANGNUNNNNNNUNNNNU .(((....[[[[[)))..]]]]]...... |
40.0 | |||
antaRNA_0 | CGCAGCAUAUAGAUGCUCUCUGUUUUUGU .[[[....{{{{{]]]..}}}}}...... |
41.3 | 0.0 | 0.0 | 0.0 |
antaRNA_1 | GGCCGGAUGCUAAGGUUAUUAGUUUAUGU .[[[....{{{{{]]]..}}}}}...... |
41.3 | 0.0 | 0.0 | 0.0 |
antaRNA_2 | AGCGGUUUCACAAUGUUCUUGUGUUUGUU .[[[....{{{{{]]]..}}}}}...... |
37.9 | 0.0 | 0.0 | 0.0 |
antaRNA_3 | UGUCGUCUACUGAGGCUCUUAGUUGUAAU .[[[....{{{{{]]]..}}}}}...... |
41.3 | 0.0 | 0.0 | 0.0 |
antaRNA_4 | CGCCGUAUCUAAAGGCUAUUUGGUAGAAU .[[[....{{{{{]]]..}}}}}...... |
41.3 | 0.0 | 0.0 | 0.0 |
antaRNA_5 | GGCCGUACACUAAGGUUAUUGGUUUGUAU .[[[....{{{{{]]]..}}}}}...... |
41.3 | 0.0 | 0.0 | 0.0 |
antaRNA_6 | CGUAGUAUGAAGAUGCUCUCUUCUAAAGU .[[[....{{{{{]]]..}}}}}...... |
37.9 | 0.0 | 0.0 | 0.0 |
antaRNA_7 | CGUCGUCUAAUGAGGCUGUCAUUUCAAUU .[[[....{{{{{]]]..}}}}}...... |
41.3 | 0.0 | 0.0 | 0.0 |
antaRNA_8 | GGUCGACUCAUUAGGCUUUGGUGUAUUAU .[[[....{{{{{]]]..}}}}}...... |
41.3 | 0.0 | 0.0 | 0.0 |
antaRNA_9 | CGUCGUCUUGAAAGGCUAUUUCAUUGAUU .[[[....{{{{{]]]..}}}}}...... |
37.9 | 0.0 | 0.0 | 0.0 |
Download:
Visualization of the selected sequence
[save as SVG]
Explicit constraint violations are highlighted in red.
Visualization done with
forna
(Kerpedjiev et al., 2015)
Job resubmission
usability assessment
When using AntaRNA please cite :
- Robert Kleinkauf, Martin Mann and Rolf Backofen
AntaRNA - Ant Colony Based RNA Sequence Design
Bioinformatics, 31(19), pages 3114-3121, 2015. - Robert Kleinkauf, Torsten Houwaart, Rolf Backofen, and Martin Mann
AntaRNA - multi-objective inverse folding of pseudoknot RNA using ant-colony optimization
BMC Bioinformatics, 16(1), pages 1-7, 2015. - Martin Raden, Syed M Ali, Omer S Alkhnbashi, Anke Busch, Fabrizio Costa, Jason A Davis, Florian Eggenhofer, Rick Gelhausen, Jens Georg, Steffen Heyne, Michael Hiller, Kousik Kundu, Robert Kleinkauf, Steffen C Lott, Mostafa M Mohamed, Alexander Mattheis, Milad Miladi, Andreas S Richter, Sebastian Will, Joachim Wolff, Patrick R Wright, and Rolf Backofen
Freiburg RNA tools: a central online resource for RNA-focused research and teaching
Nucleic Acids Research, 46(W1), W25-W29, 2018.
Results are computed with AntaRNA version 1.1.2 using Vienna RNA package 2.1.8 or pKiss (2014-03-17)