Freiburg RNA Tools
CRISPRloci - Results
BIF
IFF
CRISPRloci 3195732

Input and runtime details for job 3195732 (precomputed example)

Input Parameters

? Sequence(s)[.fa]
? Sequence type Single Genome DNA (FASTA format)

Genome information

? DNA sequence completeness complete

Parameters concerning CRISPR arrays

? CRISPR array orientation prediction Yes
? ML model to use all
? Detect the IS-element Yes
? Compute degenerated repeat Yes
? Fast run mode No
? Enhancement of the predicted array Yes
? Enhancement of the start and end of the array Yes
? Min. repeat length in the array21
? Max. repeat length in the array55
? Min. spacer length in the array18
? Max. spacer length in the array78
? Min. number of repeats in the array3
? Max. edit distance for evaluated array enhancement6
? Max. number of identical spacers in the array4
? Max. number of consecutive identical spacers in the array3
? Max. length of the spacer's margin for the degenerated search30

Parameters concerning Cas genes

? ML model to run combination of both
? Select the classifiers ERT
? Select the regressors ERT
? Max. number of contiguous gaps in a cassette2

Parameters for CRISPR repeat input

? Hit sensitivity (e-value threshold)0.01

Parameters for Virus DNA/RNA input

? Hit sensitivity (e-value threshold)0.000001

Job ID 3195732 (server version trunk)

?Job Submitted & Queued@ Fri Dec 18 07:37:00 CET 2020
?CRISPRloci Started@ Fri Dec 18 07:37:09 CET 2020
?CRISPRloci Finished & Post-Processing@ Fri Dec 18 07:50:33 CET 2020
?Job Completed@ Fri Dec 18 07:50:55 CET 2020
 DIRECT ACCESS: https://rna.informatik.uni-freiburg.de/RetrieveResults.jsp?jobID=3195732&toolName=CRISPRloci ( 30 days expiry )

Description of the job

Synechocystis sp. PCC 6803 plasmid pSYSA (NC_005230)

? Overview of CRISPR-Cas system on the genome

Zoom:     Download CRISPR-Cas system    
Zoom:     Download
Legend

CRISPR Array Summary

Sort by selecting a column name. [Download Table Data]
ID Start End Length Consensus repeat Repeat Length Average Spacer Length Number of spacers Strand Category subtype
CRISPR1 16310 19901 3592 GTTTCAGTCCCGATCGCCGGGATTAGTAGAAGGAAAG 37 35 49 Reversed Bona-fide I-D
CRISPR2 68499 72778 4280 GTTTCAGTCCCCTGACGGGGAAAAGAGGGTGTTGAAC 37 38 56 Reversed Bona-fide III-D
CRISPR3 90105 92958 2854 GTCTCCACTCGTAGGAGAAATTAATTGATTGGAAAC 36 38 38 Forward Bona-fide III-B

CRISPR Details for selection from above

[Download Data]

Summary of Self-targeting

Sort by selecting a column name. [Download Table Data]
#mismatches Spacer.Len SpacerID ArrayID Spacer.Start.Alin Spacer.End.Align Start-Area.selftargets End-Area.selftargets Category Detail
17 38 S25 Array1 31 2 38671 38700 ProphageRegion ProphageRegion
18 36 S26 Array1 22 1 35435 35456 ProphageRegion ProphageRegion
24 39 S24 Array1 28 10 37975 37993 ProphageRegion ProphageRegion
18 35 S1 Array2 33 12 34207 34228 ProphageRegion ProphageRegion
18 41 S36 Array2 37 7 33139 33168 ProphageRegion ProphageRegion
22 43 S39 Array2 32 6 31974 32000 ProphageRegion ProphageRegion
28 41 S12 Array2 18 5 30803 30816 ProphageRegion ProphageRegion
29 46 S32 Array2 27 6 36609 36630 ProphageRegion ProphageRegion
10 37 S1 Array3 36 1 34555 34590 ProphageRegion ProphageRegion
18 37 S10 Array3 26 3 33312 33335 ProphageRegion ProphageRegion
18 40 S5 Array3 34 4 33904 33934 ProphageRegion ProphageRegion
21 38 S9 Array3 29 7 37695 37717 ProphageRegion ProphageRegion
9 32 S1 Array_1 31 1 50583 50613 GenomicRegion GenomicRegion
12 33 S2 Array_1 32 1 28663 28694 GenomicRegion GenomicRegion
14 35 S23 Array_1 34 6 52165 52193 CasgeneRegion csx1_III-D(Prot70)
14 35 S3 Array_1 26 2 78970 78994 GenomicRegion GenomicRegion
14 36 S28 Array_1 33 3 12657 12687 CasgeneRegion csc1_I-D(Prot13)
14 38 S45 Array_1 36 2 53132 53166 CasgeneRegion csm6_III-D(Prot71)
16 37 S12 Array_1 31 2 30258 30287 GenomicRegion GenomicRegion
17 34 S15 Array_1 33 12 3317 3338 GenomicRegion GenomicRegion
17 34 S47 Array_1 25 4 100467 100488 GenomicRegion GenomicRegion
17 34 S7 Array_1 23 2 76778 76799 GenomicRegion GenomicRegion
17 35 S22 Array_1 24 1 62145 62168 CasgeneRegion cas10_III-D(Prot76)
17 36 S10 Array_1 34 10 80708 80732 CasgeneRegion cmr6_III-B(Prot93)
17 36 S27 Array_1 33 9 29126 29150 GenomicRegion GenomicRegion
17 36 S31 Array_1 30 6 44999 45023 GenomicRegion GenomicRegion
17 36 S32 Array_1 25 1 66112 66136 CasgeneRegion cas2_III-D(Prot81)
17 36 S9 Array_1 34 10 80708 80732 CasgeneRegion cmr6_III-B(Prot93)
18 36 S36 Array_1 34 13 58558 58579 CasgeneRegion csm3_III-D(Prot75)
18 36 S49 Array_1 27 7 85650 85670 CasgeneRegion cas10_III-B(Prot98)
18 37 S6 Array_1 35 10 96811 96836 GenomicRegion GenomicRegion
18 38 S18 Array_1 31 5 48144 48170 GenomicRegion GenomicRegion
18 38 S20 Array_1 31 5 48144 48170 GenomicRegion GenomicRegion
18 38 S21 Array_1 28 1 97100 97127 GenomicRegion GenomicRegion
18 38 S48 Array_1 36 11 21290 21315 GenomicRegion GenomicRegion
18 38 S4 Array_1 28 1 12992 13019 CasgeneRegion csc1_I-D(Prot13)
18 38 S5 Array_1 29 2 62575 62602 CasgeneRegion cas10_III-D(Prot76)
19 36 S39 Array_1 31 9 101207 101229 GenomicRegion GenomicRegion
19 36 S40 Array_1 31 9 101207 101229 GenomicRegion GenomicRegion
19 37 S38 Array_1 33 11 73712 73734 GenomicRegion GenomicRegion
19 37 S42 Array_1 36 15 6818 6839 CasgeneRegion cas3_I-D(Prot10)
20 36 S16 Array_1 23 4 14029 14048 CasgeneRegion cas6_I-D(Prot14)
20 36 S41 Array_1 32 13 25314 25333 GenomicRegion GenomicRegion
20 37 S37 Array_1 25 5 93770 93790 GenomicRegion GenomicRegion
21 35 S29 Array_1 34 19 50558 50573 GenomicRegion GenomicRegion
21 35 S35 Array_1 25 9 75204 75220 GenomicRegion GenomicRegion
21 37 S8 Array_1 32 15 8323 8340 CasgeneRegion cas3_I-D(Prot10)
21 38 S46 Array_1 24 1 43610 43633 GenomicRegion GenomicRegion
22 35 S11 Array_1 18 5 27874 27887 GenomicRegion GenomicRegion
22 36 S43 Array_1 32 18 42967 42981 GenomicRegion GenomicRegion
22 40 S44 Array_1 31 5 79806 79832 GenomicRegion GenomicRegion
23 42 S17 Array_1 27 3 38824 38848 GenomicRegion GenomicRegion
23 42 S19 Array_1 27 3 38824 38848 GenomicRegion GenomicRegion
25 37 S34 Array_1 27 15 98193 98205 GenomicRegion GenomicRegion
12 41 S27 Array_2 40 2 8298 8334 CasgeneRegion cas3_I-D(Prot10)
13 36 S15 Array_2 34 2 57426 57458 CasgeneRegion csm3_III-D(Prot74)
14 37 S53 Array_2 36 6 9031 9061 CasgeneRegion cas10d_I-D(Prot11)
16 36 S23 Array_2 30 2 61912 61940 CasgeneRegion cas10_III-D(Prot76)
16 38 S10 Array_2 35 8 7634 7661 CasgeneRegion cas3_I-D(Prot10)
16 38 S13 Array_2 32 2 11366 11396 CasgeneRegion cas10d_I-D(Prot11)
18 35 S3 Array_2 22 2 14491 14511 CasgeneRegion cas4_I-D(Prot15)
18 36 S8 Array_2 34 11 88701 88724 CasgeneRegion cas1_III-B(Prot100)
18 37 S24 Array_2 36 10 94163 94189 GenomicRegion GenomicRegion
19 36 S33 Array_2 23 1 85891 85913 CasgeneRegion cas10_III-B(Prot98)
19 37 S18 Array_2 32 8 50276 50300 GenomicRegion GenomicRegion
19 37 S20 Array_2 32 8 50276 50300 GenomicRegion GenomicRegion
19 39 S44 Array_2 28 3 84194 84219 CasgeneRegion cmr3_III-B(Prot97)
19 41 S28 Array_2 39 8 73156 73187 GenomicRegion GenomicRegion
19 43 S54 Array_2 41 6 8225 8260 CasgeneRegion cas3_I-D(Prot10)
20 35 S26 Array_2 32 14 5789 5807 CasgeneRegion wyl_I-D(Prot9)
20 38 S29 Array_2 28 5 43284 43307 GenomicRegion GenomicRegion
20 46 S4 Array_2 43 6 66561 66598 GenomicRegion GenomicRegion
21 36 S37 Array_2 33 15 50333 50351 GenomicRegion GenomicRegion
21 37 S14 Array_2 31 11 53605 53625 CasgeneRegion csm6_III-D(Prot71)
21 37 S22 Array_2 19 1 52095 52113 CasgeneRegion csx1_III-D(Prot70)
21 38 S35 Array_2 34 13 9243 9264 CasgeneRegion cas10d_I-D(Prot11)
21 39 S31 Array_2 34 13 67471 67492 GenomicRegion GenomicRegion
22 37 S52 Array_2 23 5 9838 9856 CasgeneRegion cas10d_I-D(Prot11)
22 40 S25 Array_2 33 11 29530 29552 GenomicRegion GenomicRegion
22 40 S45 Array_2 39 13 26750 26776 GenomicRegion GenomicRegion
22 41 S17 Array_2 38 14 103071 103095 GenomicRegion GenomicRegion
22 41 S19 Array_2 38 14 103071 103095 GenomicRegion GenomicRegion
23 41 S40 Array_2 40 16 54234 54258 CasgeneRegion csm3_III-D(Prot72)
24 37 S56 Array_2 21 8 67892 67905 GenomicRegion GenomicRegion
24 39 S41 Array_2 37 19 95598 95616 GenomicRegion GenomicRegion
24 45 S46 Array_2 35 5 89646 89676 CasgeneRegion cas2_III-B(Prot101)
25 40 S21 Array_2 19 1 75183 75201 GenomicRegion GenomicRegion
25 46 S7 Array_2 39 12 85489 85516 CasgeneRegion cas10_III-B(Prot98)
26 40 S48 Array_2 29 14 78563 78578 GenomicRegion GenomicRegion
26 40 S50 Array_2 29 14 78563 78578 GenomicRegion GenomicRegion
26 42 S9 Array_2 18 1 86963 86980 CasgeneRegion cas10_III-B(Prot98)
27 40 S30 Array_2 30 16 9297 9311 CasgeneRegion cas10d_I-D(Prot11)
27 41 S5 Array_2 22 7 82523 82538 CasgeneRegion cmr5_III-B(Prot94)
27 42 S43 Array_2 24 8 28458 28474 GenomicRegion GenomicRegion
27 47 S2 Array_2 30 5 39973 39998 GenomicRegion GenomicRegion
31 44 S11 Array_2 13 1 67759 67771 GenomicRegion GenomicRegion
31 44 S38 Array_2 21 8 24892 24905 GenomicRegion GenomicRegion
14 36 S22 Array_3 32 1 100595 100626 GenomicRegion GenomicRegion
15 36 S16 Array_3 33 4 14772 14801 CasgeneRegion cas4_I-D(Prot15)
16 37 S29 Array_3 34 5 74194 74223 GenomicRegion GenomicRegion
16 38 S11 Array_3 32 1 7811 7842 CasgeneRegion cas3_I-D(Prot10)
16 38 S18 Array_3 32 1 60246 60277 CasgeneRegion csm3_III-D(Prot75)
16 38 S35 Array_3 37 4 30557 30590 GenomicRegion GenomicRegion
16 40 S17 Array_3 36 5 12218 12249 CasgeneRegion csc2_I-D(Prot12)
16 40 S25 Array_3 38 4 8040 8074 CasgeneRegion cas3_I-D(Prot10)
17 36 S12 Array_3 30 5 11024 11049 CasgeneRegion cas10d_I-D(Prot11)
17 37 S6 Array_3 28 1 99613 99640 GenomicRegion GenomicRegion
18 37 S14 Array_3 31 7 4659 4683 GenomicRegion GenomicRegion
18 37 S4 Array_3 28 2 84076 84102 CasgeneRegion cmr3_III-B(Prot97)
19 38 S8 Array_3 36 11 7261 7286 CasgeneRegion cas3_I-D(Prot10)
20 40 S21 Array_3 39 15 82816 82840 CasgeneRegion cmr4_III-B(Prot95)
20 41 S38 Array_3 32 3 20950 20979 GenomicRegion GenomicRegion
21 37 S13 Array_3 36 17 26912 26931 GenomicRegion GenomicRegion
21 37 S2 Array_3 25 6 47533 47552 GenomicRegion GenomicRegion
21 42 S15 Array_3 36 9 222 249 GenomicRegion GenomicRegion
22 36 S33 Array_3 35 19 97246 97262 GenomicRegion GenomicRegion
22 38 S23 Array_3 32 12 29362 29382 GenomicRegion GenomicRegion
22 40 S26 Array_3 26 5 80454 80475 CasgeneRegion cmr6_III-B(Prot93)
23 40 S28 Array_3 25 3 2882 2904 GenomicRegion GenomicRegion
24 40 S36 Array_3 39 20 77249 77268 GenomicRegion GenomicRegion
24 41 S24 Array_3 31 10 45779 45800 GenomicRegion GenomicRegion
24 43 S31 Array_3 30 6 86204 86228 CasgeneRegion cas10_III-B(Prot98)
24 48 S34 Array_3 36 2 49364 49398 GenomicRegion GenomicRegion
25 39 S19 Array_3 18 4 20508 20522 GenomicRegion GenomicRegion
25 47 S27 Array_3 46 12 74443 74477 GenomicRegion GenomicRegion
27 42 S32 Array_3 37 19 89961 89979 GenomicRegion GenomicRegion

CAS Protein Classification

Sort by selecting a column name. [Download Table Data]
ID Input-ID Name Subtype Module Cassette Strand Start End Length
Prot10 cas3 I-D interference 2 plus 6349 8517 723
Prot100 cas1 III-B adaptation 1 plus 88627 89616 330
Prot101 cas2 III-B adaptation 1 plus 89620 89898 93
Prot11 cas10d I-D interference 2 plus 8531 11458 976
Prot12 csc2 I-D interference 2 plus 11524 12513 330
Prot13 csc1 I-D interference 2 plus 12674 13438 255
Prot14 cas6 I-D processing 2 plus 13441 14229 263
Prot15 cas4 I-D adaptation 2 plus 14222 14794 191
Prot16 cas1 I-D adaptation 2 plus 14804 15781 326
Prot17 cas2 I-D adaptation 2 plus 15813 16097 95
Prot70 csx1 III-D interference 3 plus 51537 52805 423
Prot71 csm6 III-D interference 3 minus 52881 53996 372
Prot72 csm3 III-D interference 3 minus 54005 56392 796
Prot73 csx19 III-D interference 3 minus 56394 56954 187
Prot74 csm3 III-D interference 3 minus 56954 58522 523
Prot75 csm3 III-D interference 3 minus 58527 60902 792
Prot76 cas10 III-D interference 3 minus 60905 62581 559
Prot77 cas6 III-D processing 3 plus 62911 64011 367
Prot78 csx18 III-D interference 3 minus 64005 64319 105
Prot79 unknown III-D potential_cas 3 minus 64316 64690 125
Prot80 cas1 III-D adaptation 3 plus 64822 65832 337
Prot81 cas2 III-D adaptation 3 plus 65842 66123 94
Prot9 wyl I-D interference 2 minus 5340 6284 315
Prot93 cmr6 III-B interference 1 minus 80203 82140 646
Prot94 cmr5 III-B interference 1 minus 82196 82591 132
Prot95 cmr4 III-B interference 1 minus 82630 83409 260
Prot96 unknown III-B potential_cas 1 plus 83501 83881 127
Prot97 cmr3 III-B interference 1 minus 83905 85017 371
Prot98 cas10 III-B interference 1 minus 85199 88138 980
Prot99 unknown III-B potential_cas 1 minus 88253 88546 98

CAS Protein Sequence for selection from above

Job resubmission

Use the following button if you want to resubmit the job with altered input or parameterization:
Feeds the job parameters to the input page to resubmit the job.

de.NBI usability assessment

Please support us by filling this short quality survey for evaluating this de.NBI service.

When using CRISPRloci please cite :

Results are computed with CRISPRloci version 1.1.0