CARNA - Ensemble Alignment

CARNA is a tool for multiple alignment of RNA molecules. CARNA requires only the RNA sequences as input and will compute base pair probability matrices and align the sequences based on their full ensembles of structures. Alternatively, you can also provide base pair probability matrices (dot plots in .ps format) or fixed structures (as annotation in the FASTA alignment) for your sequences. If you provide fixed structures, only those structures and not the entire ensemble of possible structures is aligned. In contrast to LocARNA, CARNA does not pick the most likely consensus structure, but computes the alignment that fits best to all likely structures simultaneously. Hence, CARNA is particularly useful when aligning RNAs like riboswitches, which have more than one stable structure. Also, CARNA is not limited to nested structures, but is able to align arbitrary pseudoknots.

For articles describing the tool and webserver refer to the reference section below. Please cite us when using our tools.
For more information check the help page.

Try CARNA with these examples:

pseudoknot alignment (input|result)
fixed pseudoknot structures (input|result)
tRNA alignment (input|result)
multiple conserved structures (input|result)

Input Parameter

Sequence Input in FASTA Format:

[clear]

>B.pertussis.1
GCACCGACCCGCGUCACAAGCAGCGUCAAGGCUAACCCAGUUAGCGGUACGCAACGGAUUUAUUCAAGGAACAGUCAUGGCCCGUAUUGCUGGCAUUAACAUUCCGCCG
...((((((((((..........AAA...BB....CCC....))))))))))............................bb........aaa............ccc. #FS
>Pseudoalteromonas_tu.1
AAGUUUGAUUAUUGGUUGAGUAUCCUAACGGGCUUUUCAACAAAAUAUAGUCAAAUUCUUUUAUAGGAGAUGUGUUAGUGGCCCGUAUAGCUGGCAUUAACGUCCCUGAU
...((((((((((..........AAA..BBBB....CCC......))))))))))..........................bbbb......aaa............ccc. #FS
>Psychromonas_ingraha.1
AAUUAUCAUUUGUCGAGUAUCCUACCGGGCUUUUCACAAAUGAAUCGUUAACUUUUAAGGAGUGCAUAGUGGCCCGUAUCGCUGGCAUUAACGUUCCUGAU
...((((((((((.......AAA..BBBB....CC))))))))))...........................bbbb......aaa.............cc. #FS
>Haemophilus_somnus_1.1
UCCUUGAUAUACUGUUUGAGUAUCCUGAAACGGGCUUUUCAAGAUCAGUAUAUCAAAUUUAAUCAAUAAAAUAAUAGGAGUGCAUAGUGGCCCGUAUUGCAGGCAUUAACAUUCCUGAU
...((((((((((..........AAA....BBBB....CCC.....))))))))))..................................bbbb......aaa............ccc. #FS
>Pseudomonas_syringae.1
UUAUCUCGCGCCCUAUUUCUUGGCUUCCGGGGCGUAGGUAGCUGUCAAUUGGAGUCCCACUGAAUGGCCCGUAUUGCAGGCGUUAACAUUCCAGAU
...((((((((((.....AAABB....CC))))))))))............................bb........aaa.............cc. #FS

Predict dot plots:

without pseudoknots (RNAfold) with pseudoknots (NUPACK)

Upload dot plots:
( PostScript format ):

[clear]

Note: each dot plot has to correspond to a sequence from the above FASTA input.

[+] Scoring Parameters [-] Scoring Parameters

Use RIBOSUM:

Structure Weight:

Indel Opening Score:

Indel Score:

Match Score:

Mismatch Score:

Minimal Pair Probability:

Maximal Difference for Sizes of Matched Arcs:

off

Maximal Difference for Alignment Edges:

off

[+] Other Parameter [-] Other Parameter

Ignore Constraints:

Disallow Lonely Pairs:

Search Time Limit (in milliseconds):

Description:

Your Email:

(optional)
(optional)

Main Menu

Freiburg RNA Tools

Interaction Prediction

Seq-Str Alignment

CRISPR

Sequence Design

Splicing

SNP & Mutation

Classification

Gene set extension

MoDPepInt Server

CPSP-Tools Server

Galaxy-FR

CMV server

Teaching

CARNA - Ensemble Alignment

Input Parameter

[+] Scoring Parameters [-] Scoring Parameters

[+] Other Parameter [-] Other Parameter