Download an archive file containing the complete results produced by the job in
[.zip]
format.
Input and runtime details for job 6576753 (precomputed example)
Sequence Parameters
 RNA-1 | GCCACUGCUUUUCUUUGAUGUCCCCAUUUUGUGGAGCCCAUCAACCCCGCCAUUUCGGUUCAAGGUUGGUGGGUUUUUU | ||
| Index first position of RNA-1 | 1 | ||
| RNA-2 | TCATGAAAGATAGTACTGTCGCCGCGTCTAAAATGCGCAAACGTGAACGCAATCGATTACGTAAATGATAGATATGTGAAACAAGACATATTTTTGTGAGCAATGATTTTTATAATAGGCTCCGCAGAAACACGAAATATTTAGAAACGCAAATTGCGTTCTTTTCACTCCCGCAAGGGATTTCAAACAGTGGCATACATATGAAAAAAACTTTACTCGCAGTCAGCGCAGCGCTGGCGCTCACCTCATCTTTTACTGCTAACGCAGCAGAAAATGATCAGCCGCAGTATTTGTCCGACT | ||
| Index first position of RNA-2 | -200 |
Mutation Parameters
| Mutation candidates | base pairs from mfe interaction only | ||
| Ignore AU base pairs | no | ||
| Ignore GU base pairs | no | ||
| Ignore GC base pairs | no | ||
| Ignore lonely base pairs | yes | ||
| Ignore helix ends | yes | ||
| Ignore helix ends of mfe | no | ||
| Mutations to generate | flip (e.g. GC to CG) |
Evaluation Parameters
| Classification combination | mfeCover + E | ||
| Sorting within final classes | minDeltaE |
IntaRNA Parameters
| Max. interaction length | not provided | ||
| Max. absolute energy of an interaction | 0 | ||
| No lonely base pairs | yes | ||
| No GU at helix ends | yes | ||
| Min. number of basepairs in seed | 6 | ||
| Max. Number of mismatches in seed | 0 | ||
| Maximal energy | 0 | ||
| Minimal unpaired probability (per RNA) | 0 | ||
| Seed position (RNA-1) | not provided | ||
| Seed position (RNA-2) | not provided | ||
| Ignore seeds with GU base pairs | no | ||
| Ignore seeds with GU ends | yes | ||
| Temperature for energy computation | 37.0 | ||
| Access. RNA-1: folding window size | 150 | ||
| Access. RNA-1: max. basepair distance | 100 | ||
| Access. RNA-2: folding window size | 150 | ||
| Access. RNA-2: max. basepair distance | 100 | ||
| Energy parameter set (Vienna package) | Turner model, 2004 |
Job ID 6576753 (server version trunk)
 | Job Submitted & Queued | @ Thu Feb 06 15:34:59 CET 2020 | |
| CopomuS Started | @ Thu Feb 06 15:36:29 CET 2020 | |
| CopomuS Finished & Post-Processing | @ Thu Feb 06 15:36:53 CET 2020 | |
| Post-Processing Finished | @ Thu Feb 06 15:36:53 CET 2020 | |
| Job Completed | @ Thu Feb 06 15:36:55 CET 2020 |
DIRECT ACCESS: http://rna.informatik.uni-freiburg.de/RetrieveResults.jsp?jobID=6576753&toolName=CopomuS ( 30 days expiry )
Description of the job
Verification of RybB-tsx interaction in Salmonella by Papenfort et al. (2010) was originally using C2G:G-8C. (note, here we use tsx sequence = genomic region [-200,+100] around start codon)
Verification of RybB-tsx interaction in Salmonella by Papenfort et al. (2010) was originally using C2G&G-8C. (note, here we use tsx sequence = genomic region [-200,+100] around start codon)
Output
When using CopomuS please cite :
- Martin Raden, Fabio Gutmann, Michael Uhl, and Rolf Backofen
CopomuS - ranking compensatory mutations to guide RNA-RNA interaction
International Journal of Molecular Sciences, 21(11),3852, 2020. - Martin Mann, Patrick R. Wright, and Rolf Backofen
IntaRNA 2.0: enhanced and customizable prediction of RNA–RNA interactions
Nucleic Acids Research, 2017, 45 (W1), W435–W439. - Martin Raden, Syed M Ali, Omer S Alkhnbashi, Anke Busch, Fabrizio Costa, Jason A Davis, Florian Eggenhofer, Rick Gelhausen, Jens Georg, Steffen Heyne, Michael Hiller, Kousik Kundu, Robert Kleinkauf, Steffen C Lott, Mostafa M Mohamed, Alexander Mattheis, Milad Miladi, Andreas S Richter, Sebastian Will, Joachim Wolff, Patrick R Wright, and Rolf Backofen
Freiburg RNA tools: a central online resource for RNA-focused research and teaching
Nucleic Acids Research, 46(W1), W25-W29, 2018.
Results are computed with CopomuS version dev using IntaRNA 3.1.5
About this web server
|
version 5.0.10
|
Copyright © 2012 - 2024 Bioinformatics Group Freiburg
|
|
Imprint and Disclaimer
|
Imprint and Disclaimer