Freiburg RNA Tools
GLASSgo - Results
BIF
IFF
GLASSgo 8172565

Input and runtime details for job 8172565 (precomputed example)

Sequence Parameters

? Query sRNA in FASTA[.fa]

Search Parameters

? Taxon selectionnot provided
? Parameter setup automatic
? Maximum allowed E-value1
? Minimum allowed identity [%]58
? Structure-based clustering on

Structure-based clustering

? Structure-based filteringauto
? Manual value for filtering2

Job ID 8172565 (server version trunk)

?Job Submitted & Queued@ Fri Jul 21 11:23:41 CEST 2017
?Processing Started@ Fri Jul 21 11:23:59 CEST 2017
?GLASSgo Finished & Post-Processing@ Fri Jul 21 11:43:02 CEST 2017
?Post-Processing Finished@ Fri Jul 21 11:43:12 CEST 2017
?Job Completed@ Fri Jul 21 11:43:12 CEST 2017
 DIRECT ACCESS: http://rna.informatik.uni-freiburg.de:80/RetrieveResults.jsp?jobID=8172565&toolName=GLASSgo ( 30 days expiry )

The job description you specified

IsaR1 from PCC7424 (default parameters) - Example from Methods in Molecular Biology chapter - 'Workflow for a computational analysis of an sRNA candidate in bacteria'

? Output download complete results [zip]

In the following FASTA output, the input sequence is given top-most followed by the identified homologs.
If only the input sequence is shown, no homologs could be found.

>IsaR1_PCC7424
ACAGTGTTCTCCTCTCAAGGATCGGCAGGTGAGGCCGCCGGCAGTCAAGAAATGCGGCTCCCTGTTT
>gi|219862254|gb|CP001344.1|:2260409-2260473 Cyanothece sp. PCC 7425, complete genome-p.c.VAL:61.73%-taxID:395961
AGTGTTCTCCTCTCTGAGGAATAGGCAGGTGGGGTCAGGAAGCGCGATGCCGATCGGCCCCCTGT
>gi|757114190|dbj|AP014642.1|:c1707738-1707673 Leptolyngbya boryana DNA, complete genome, strain: dg5-p.c.VAL:59.04%-taxID:1184
CAGTGTTCTCCTCTCTAGAGGATCGGCAGATGGACGTAGAAAACGATGGATTTTTTACGTCCGCTT
>gi|218165370|gb|CP001287.1|:c2683980-2683916 Cyanothece sp. PCC 8801, complete genome-p.c.VAL:62.5%-taxID:41431
TTGTGTTCTCCTCTCAAGGATCGGCAGGTGGAATCGTTCAGGACAGACGGTTCCCCTCTTTTTTG
>gi|413968727|gb|CP003284.1|:c2771791-2771726 Anabaena sp. 90 chromosome chANA01, complete sequence-p.c.VAL:58.33%-taxID:46234
AGTGTTCTCCTCTCTTTAAAGAATCGGCAGGCGGGATTAGTCAGCAGCAGCAGACTTTTCCCTCTT
>gi|428238862|gb|CP003614.1|:6250965-6251034 Oscillatoria nigro-viridis PCC 7112, complete genome-p.c.VAL:63.1%-taxID:179408
AGTGTTCTCCTCTCAAAGGATCGGCAGACGGGGGCAGTCGGCAATGGTAGACTGTTCCCGCATTTTTTTT
>gi|757114186|dbj|AP014638.1|:c1707738-1707673 Leptolyngbya boryana DNA, complete genome, strain: IAM M-101-p.c.VAL:59.04%-taxID:411966
CAGTGTTCTCCTCTCTAGAGGATCGGCAGATGGACGTAGAAAACGATGGATTTTTTACGTCCGCTT
>gi|186463002|gb|CP001037.1|:c5303413-5303346 Nostoc punctiforme PCC 73102, complete genome-p.c.VAL:63.41%-taxID:63737
CAGTGTTCTCCTCTCTTTTAAGGATCGGCAGACGGGATTAGCCAGCAGTAGCAGGCTCGTCCCTCTTT
>gi|924287285|gb|CP011456.1|:c3321372-3321307 Anabaena sp. wa102 strain WA102, complete genome-p.c.VAL:60.24%-taxID:1647413
AGTGTTCTCCTCTCTTTAAAGGATCGGCAGGCGGGATTAGTCAGCAGCAGCAGACTTTTCCCTCTT
>gi|298231532|gb|CP002059.1|:c1052203-1052137 'Nostoc azollae' 0708, complete genome-p.c.VAL:63.41%-taxID:551115
CAGTGTTCTCCTCTCTTTAAAGGATCGGCAGACGGGATTGGCCAGCGGTAGCAGGCTTATCCCTCTT
>gi|47118315|dbj|BA000039.2|:2061187-2061251 Thermosynechococcus elongatus BP-1 DNA, complete genome-p.c.VAL:59.04%-taxID:197221
AGTGTTCTCCTCTCTGAGGAATCGGCAGGCGGGGTCAGTCATTGCGACGACCCCTTTTTTCTTGA
>gi|427998918|gb|CP003607.1|:c4544800-4544736 Oscillatoria acuminata PCC 6304, complete genome-p.c.VAL:67.09%-taxID:56110
AGTGTTCTCCTCTCAAAAAGGATCGGCAGGCGGGATTGGTCAGCAATAGCGGCTAGTCCCGTATT
>gi|427363208|gb|CP003552.1|:6140934-6141000 Nostoc sp. PCC 7524, complete genome-p.c.VAL:67.09%-taxID:28072
CAGTGTTCTCCTCTCTTTAAGGATCGGCAGACGGGATTAGTCGGCGGTAGCAGACTCGTCCCTCTTT
>gi|428676849|gb|CP003659.1|:2096673-2096738 Anabaena cylindrica PCC 7122, complete genome-p.c.VAL:62.96%-taxID:272123
AGTGTTCTCCTCTCTTTAAAGGATCGGCAGACGGGATAGCCAGCAGCAGCAGGTTTGTCCCTCTTT
>gi|427983362|gb|CP003591.1|:c3881832-3881766 Geitlerinema sp. PCC 7407, complete genome-p.c.VAL:65.43%-taxID:1173025
CAGTGTTCTCCTCTCAAAAGGATCGGCAGGTGGGGGCAGTCGTGTGACTGGTCCCCAATTTCTTTTT
>gi|218169741|gb|CP001291.1|:2604464-2604530 Cyanothece sp. PCC 7424, complete genome-p.c.VAL:100.0%-taxID:65393
ACAGTGTTCTCCTCTCAAGGATCGGCAGGTGAGGCCGCCGGCAGTCAAGAAATGCGGCTCCCTGTTT
>gi|428267688|gb|CP003653.1|:c2403886-2403820 Stanieria cyanosphaera PCC 7437, complete genome-p.c.VAL:72.73%-taxID:111780
CAGTGTTCTTCTCTCAAGGAATCGGCAGGCGGGATCGCGAGTCATTAAAAAAGCGACTCCCCTGTTT
>gi|428262672|gb|CP003646.1|:c3881402-3881334 Gloeocapsa sp. PCC 7428, complete genome-p.c.VAL:60.71%-taxID:1173026
CAGTGTTCTCCTCTCTTTTAAAGATCGGCAGACGGGGTTGGTCAGCAGTAGCAGACTGATCCCTATTTT
>gi|427375308|gb|CP003558.1|:35586-35653 Synechococcus sp. PCC 6312, complete genome-p.c.VAL:60.71%-taxID:195253
CAGTGTTCTCCTCTCTTGAGGAATCGGCAGGTGGGGTCAGTCGTTGGTGGCAGGCCCCATTTTTTTGC
>gi|564736995|gb|CP006735.1|:1394018-1394082 Thermosynechococcus sp. NK55 genome-p.c.VAL:59.04%-taxID:1394889
AGTGTTCTCCTCTCTGAGGAATCGGCAGGCGGGGTCAGTCATTGCGACGACCCCTTTTTTCTTGA
>gi|585302946|emb|FO818640.1|:1765908-1765977 Arthrospira sp. str. PCC 8005 chromosome, complete genome-p.c.VAL:61.18%-taxID:376219
CAGTGTTCTCCTCTCAAATCAAAGGATCGGCAGACGGGGGCGGTTGATGAAAAAACCGTTCCCGCATTTC
>gi|604876398|gb|CP007203.2|:c3766336-3766272 Nodularia spumigena CCY9414 genome-p.c.VAL:62.96%-taxID:313624
AGTGTTCTCCTCTCTTTAAGGATCGGCAGACGGGATTAGCCAGCAGCAGCAGGCTTGTCCCTCTT
>gi|47118302|dbj|BA000019.2|:2470309-2470374 Nostoc sp. PCC 7120 DNA, complete genome-p.c.VAL:63.75%-taxID:103690
CAGTGTTCTCCTCTCTTTAAGGATCGGCAGACGGGATTAGTCGGCGGTAGCAGGCTCATCCCTCTT
>gi|306980173|gb|CP002198.1|:c3002359-3002291 Cyanothece sp. PCC 7822, complete genome-p.c.VAL:90.14%-taxID:497965
ACAGTGTTCTCCTCTCAAGGATCGGCAGGTGGGACCGCTTGGCAGTCAATAAATGCGGCTCCCCTGTTT
>gi|428249989|gb|CP003630.1|:6428518-6428585 Microcoleus sp. PCC 7113, complete genome-p.c.VAL:66.67%-taxID:1173027
CAGTGTTCTCCTCTCATAAAGGATCGGCAGGTGGGGCCGGAAAGCGGTAGCGGACTGGTCTCCACTTT
>gi|427347790|gb|CP003943.1|:1716873-1716939 Calothrix sp. PCC 7507, complete genome-p.c.VAL:67.09%-taxID:99598
CAGTGTTCTCCTCTCTTTAAGGATCGGCAGACGGGATTAGCCAGCGGTAGCAGGCTTGTCCCTCTTT
>gi|427357970|gb|CP003548.1|:34917-34982 Nostoc sp. PCC 7107, complete genome-p.c.VAL:62.2%-taxID:317936
CAGTGTTCTCCTCTCTTTAAGGATCGGCAGACGGGATTAGCCAGCAGTCGCAGGCTTGTCCCTCTT
>gi|817925425|gb|CP011382.1|:4442251-4442316 Calothrix sp. 336/3, complete genome-p.c.VAL:65.0%-taxID:1337936
AGTGTTCTCCTCTCTTTAAGGATCGGCAGACGGGATCAGCCAGCGATCGCAGGCTTGTCCCTCTTT
>gi|171696371|gb|CP000806.1|:3708661-3708727 Cyanothece sp. ATCC 51142 circular chromosome, complete sequence-p.c.VAL:62.2%-taxID:43989
AGTGTTCTCCTCTCAAGGATGGATCGGCAGGTGGAATCGTTCAGCAACACAGAGACGGTTCCCCTAT
>gi|158303474|gb|CP000828.1|:1476899-1476965 Acaryochloris marina MBIC11017, complete genome-p.c.VAL:65.43%-taxID:329726
ATGTGTTCTCCTCTCAGAGGATTCGGCAGGTGGGGCCAAGGCGTTAGCGCAGCTTGGTTCCATTTTT
>gi|256588085|gb|CP001701.1|:3582092-3582156 Cyanothece sp. PCC 8802, complete genome-p.c.VAL:62.5%-taxID:395962
TTGTGTTCTCCTCTCAAGGATCGGCAGGTGGAATCGTTCAGGACAGACGGTTCCCCTCTTTTTTG
>gi|428256439|gb|CP003642.1|:3358497-3358561 Cylindrospermum stagnale PCC 7417, complete genome-p.c.VAL:62.96%-taxID:56107
AGTGTTCTCCTCTCTTTAAGGATCGGCAGACGGGATAAGCGGGCAGTAGCAGGCTTGTCCCTCTT
>gi|427368660|gb|CP003549.1|:4497665-4497731 Rivularia sp. PCC 7116, complete genome-p.c.VAL:64.2%-taxID:373994
CAGTGTTCTCCTCTCTTTAAGGAACGGCAGGCGGGATTGGTCAGCAGTTGCGGACTTGTCCCTCTTT
>gi|428006994|gb|CP003597.1|:c5096180-5096116 Chroococcidiopsis thermalis PCC 7203, complete genome-p.c.VAL:67.95%-taxID:251229
AGTGTTCTCCTCTCTTTAAGGATCGGCAGACGGGATTGGTCAGCAAGTGCGGCTAATCCCTATTT
>gi|428233323|gb|CP003610.1|:c6037460-6037395 Calothrix sp. PCC 6303, complete genome-p.c.VAL:65.0%-taxID:1170562
CAGTGTTCTCCTCTCTTTAAGGATCGGCAGACGGGATTAGCCAGCTTCAGCAGGCAGTCCCTCTTT
>gi|930349143|gb|CP012036.1|:147988-148054 Nostoc piscinale CENA21 genome-p.c.VAL:67.09%-taxID:224013
CAGTGTTCTCCTCTCTTTAAGGATCGGCAGACGGGATTAGCCAGCGGTAGCAGGCTTGTCCCTCTTT
>gi|75699950|gb|CP000117.1|:3866021-3866086 Anabaena variabilis ATCC 29413, complete genome-p.c.VAL:63.75%-taxID:240292
CAGTGTTCTCCTCTCTTTAAGGATCGGCAGACGGGATTAGTCGGCGGTAGCAGGCTCATCCCTCTT
>gi|428245228|gb|CP003620.1|:5294629-5294697 Crinalium epipsammum PCC 9333, complete genome-p.c.VAL:67.5%-taxID:1173022
AGTGTTCTCCTCTCAAATTAAGGATCGGCAGGTGGGACTGGTAAGCAAGAGCAGACTCGTCCCCGCTTT
>gi|427977893|gb|CP003590.1|:2760023-2760089 Pleurocapsa sp. PCC 7327, complete genome-p.c.VAL:78.67%-taxID:118163
AAGTGTTCTCCTCTCAAGGATCGGCAGGTGGGACCGCTAAGTCAGTATAAGGGCGGCTCTCCTGTTT

Taxonomic tree

The taxonomic tree illustrates the outcome of the GLASSgo result.
You can Each taxonomic name has a specific value, which describes the number of summarized GLASSgo hits. These values are also used for scaling the corresponding nodes.

Job resubmission

Use the following button if you want to resubmit the job with altered input or parameterization:
Feeds the job parameters to the input page to resubmit the job.

de.NBI usability assessment

Please support us by filling this short quality survey for evaluating this de.NBI service.

When using GLASSgo please cite :

Results are computed with GLASSgo version 1.4.3