Freiburg RNA Tools
GLASSgo - Results
BIF
IFF
GLASSgo 9891725

Input and runtime details for job 9891725 (precomputed example)

Sequence Parameters

? Query sRNA in FASTA[.fa]

Search Parameters

? Taxon selection Cyanobacteria
? Parameter setup manually
? Maximum allowed E-value20
? Minimum allowed identity [%]58
? Structure-based clustering on

Structure-based clustering

? Structure-based filteringauto
? Manual value for filtering2

Job ID 9891725 (server version trunk)

?Job Submitted & Queued@ Fri Jul 21 11:23:20 CEST 2017
?Processing Started@ Fri Jul 21 11:23:29 CEST 2017
?GLASSgo Finished & Post-Processing@ Fri Jul 21 11:42:00 CEST 2017
?Post-Processing Finished@ Fri Jul 21 11:42:13 CEST 2017
?Job Completed@ Fri Jul 21 11:42:14 CEST 2017
 DIRECT ACCESS: http://rna.informatik.uni-freiburg.de:80/RetrieveResults.jsp?jobID=9891725&toolName=GLASSgo ( 30 days expiry )

The job description you specified

IsaR1 from PCC6803 (adapted parameters) - Example from Methods in Molecular Biology chapter - 'Workflow for a computational analysis of an sRNA candidate in bacteria'

? Output download complete results [zip]

In the following FASTA output, the input sequence is given top-most followed by the identified homologs.
If only the input sequence is shown, no homologs could be found.

>IsaR1_PCC6803
ACAGTGTTCTCTTCTCAAGGATTCAGTAGGGGGTGGCTCGGCGATCGAGTGCTCCCTGTTTTTTTGGC
>gi|359273400|dbj|AP012277.1|:c3162204-3162137 Synechocystis sp. PCC 6803 substr. PCC-N DNA, complete genome-p.c.VAL:100.0%-taxID:1080229
ACAGTGTTCTCTTCTCAAGGATTCAGTAGGGGGTGGCTCGGCGATCGAGTGCTCCCTGTTTTTTTGGC
>gi|407955691|dbj|AP012495.1|:4842459-4842526 Bacillus subtilis BEST7613 DNA, complete genome-p.c.VAL:100.0%-taxID:1204343
ACAGTGTTCTCTTCTCAAGGATTCAGTAGGGGGTGGCTCGGCGATCGAGTGCTCCCTGTTTTTTTGGC
>gi|47118304|dbj|BA000022.2|:c3164387-3164320 Synechocystis sp. PCC 6803 DNA, complete genome-p.c.VAL:100.0%-taxID:1148
ACAGTGTTCTCTTCTCAAGGATTCAGTAGGGGGTGGCTCGGCGATCGAGTGCTCCCTGTTTTTTTGGC
>gi|662702554|gb|CP007542.1|:1933975-1934041 Synechocystis sp. PCC 6714, complete genome-p.c.VAL:90.14%-taxID:1147
TAGTGTTCTCTTCTCAAGGATTCAGTAGGGGGTGGCTCGGCGATCGGGTGCTCCCTGTTTTTTTTGC
>gi|218169741|gb|CP001291.1|:2604464-2604530 Cyanothece sp. PCC 7424, complete genome-p.c.VAL:62.65%-taxID:65393
ACAGTGTTCTCCTCTCAAGGATCGGCAGGTGAGGCCGCCGGCAGTCAAGAAATGCGGCTCCCTGTTT
>gi|359276570|dbj|AP012278.1|:c3162215-3162148 Synechocystis sp. PCC 6803 substr. PCC-P DNA, complete genome-p.c.VAL:100.0%-taxID:1080230
ACAGTGTTCTCTTCTCAAGGATTCAGTAGGGGGTGGCTCGGCGATCGAGTGCTCCCTGTTTTTTTGGC
>gi|339272262|dbj|AP012205.1|:c3163204-3163137 Synechocystis sp. PCC 6803 DNA, complete genome, strain: GT-S-p.c.VAL:100.0%-taxID:1148
ACAGTGTTCTCTTCTCAAGGATTCAGTAGGGGGTGGCTCGGCGATCGAGTGCTCCCTGTTTTTTTGGC
>gi|451779298|gb|CP003265.1|:c3161655-3161588 Synechocystis sp. PCC 6803, complete genome-p.c.VAL:100.0%-taxID:1148
ACAGTGTTCTCTTCTCAAGGATTCAGTAGGGGGTGGCTCGGCGATCGAGTGCTCCCTGTTTTTTTGGC
>gi|359270229|dbj|AP012276.1|:c3162105-3162038 Synechocystis sp. PCC 6803 substr. GT-I DNA, complete genome-p.c.VAL:100.0%-taxID:1080228
ACAGTGTTCTCTTCTCAAGGATTCAGTAGGGGGTGGCTCGGCGATCGAGTGCTCCCTGTTTTTTTGGC

Taxonomic tree

The taxonomic tree illustrates the outcome of the GLASSgo result.
You can Each taxonomic name has a specific value, which describes the number of summarized GLASSgo hits. These values are also used for scaling the corresponding nodes.

Job resubmission

Use the following button if you want to resubmit the job with altered input or parameterization:
Feeds the job parameters to the input page to resubmit the job.

de.NBI usability assessment

Please support us by filling this short quality survey for evaluating this de.NBI service.

When using GLASSgo please cite :

Results are computed with GLASSgo version 1.4.3