Freiburg RNA Tools
GLASSgo - Results
BIF
IFF
GLASSgo 7215374

Input and runtime details for job 7215374 (precomputed example)

Sequence Parameters

? Query sRNA in FASTA[.fa]

Search Parameters

? Taxon selection Cyanobacteria
? Parameter setup automatic
? Maximum allowed E-value1
? Minimum allowed identity [%]58
? Structure-based filteringauto
? Structure-based filtering value2

Job ID 7215374 (server version trunk)

?Job Submitted & Queued@ Wed Jan 18 17:51:47 CET 2017
?Processing Started@ Wed Jan 18 17:51:58 CET 2017
?GLASSgo Finished & Post-Processing@ Wed Jan 18 17:52:36 CET 2017
?Post-Processing Finished@ Wed Jan 18 17:52:37 CET 2017
?Job Completed@ Wed Jan 18 17:52:38 CET 2017
 DIRECT ACCESS: http://rna.informatik.uni-freiburg.de:80/RetrieveResults.jsp?jobID=7215374&toolName=GLASSgo ( 30 days expiry )

The job description you specified

NsiR4

? Output download complete results [zip]

In the following FASTA output, the input sequence is given top-most followed by the identified homologs.
If only the input sequence is shown, no homologs could be found.

>NsiR4_Synechocystis_sp_PCC6803
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCATTGCTTCAGTGGCGGCTTTCTTTTT
>gi|407955691|dbj|AP012495.1|:c2672591-2672522 Bacillus subtilis BEST7613 DNA, complete genome-taxID:1204343
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCATTGCTTCAGTGGCGGCTTTCTTTTT
>gi|186463002|gb|CP001037.1|:3179029-3179099 Nostoc punctiforme PCC 73102, complete genome-taxID:63737
GCAGAGTAATCTGTAATTACCCTCCGATTGCTTAACCAGACCGCCCTATTATATTTAGTGGCGGTTTTTTT
>gi|662702554|gb|CP007542.1|:c257489-257420 Synechocystis sp. PCC 6714, complete genome-taxID:1147
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCGTTGCTTCAGTGGCGGCTTTCTTTTT
>gi|359276570|dbj|AP012278.1|:c1288398-1288329 Synechocystis sp. PCC 6803 substr. PCC-P DNA, complete genome-taxID:1080230
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCATTGCTTCAGTGGCGGCTTTCTTTTT
>gi|451779298|gb|CP003265.1|:c1287796-1287727 Synechocystis sp. PCC 6803, complete genome-taxID:1148
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCATTGCTTCAGTGGCGGCTTTCTTTTT
>gi|359273400|dbj|AP012277.1|:c1288386-1288317 Synechocystis sp. PCC 6803 substr. PCC-N DNA, complete genome-taxID:1080229
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCATTGCTTCAGTGGCGGCTTTCTTTTT
>gi|667665922|dbj|AP012549.1|:5724-5792 Cyanobacterium endosymbiont of Epithemia turgida isolate EtSB Lake Yunoko DNA, complete genome-taxID:1228987
AATACATAAAGTCAATTATTAGCCTTCGATTGCTTAGGATGACTACTCACTCTTTAGTGGTATTTTTTC
>gi|169884305|gb|CP000951.1|:2203754-2203825 Synechococcus sp. PCC 7002, complete genome-taxID:32049
CGCGCTAGGTTAGCAATACCCTCCGATTGCTTATCAAGCTAGACCGTCCTCACCCAGTGGCGGTTTTTTATT
>gi|218169741|gb|CP001291.1|:c4248692-4248623 Cyanothece sp. PCC 7424, complete genome-taxID:65393
AAGACATAAAGTCAATATCACCCTCCGATTGCTTATCCAGGCCGCCCATAGTCTAGGGGCGGTTTCTCTT
>gi|339272262|dbj|AP012205.1|:c1288143-1288074 Synechocystis sp. PCC 6803 DNA, complete genome, strain: GT-S-taxID:1148
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCATTGCTTCAGTGGCGGCTTTCTTTTT
>gi|428267688|gb|CP003653.1|:c4488914-4488845 Stanieria cyanosphaera PCC 7437, complete genome-taxID:111780
TAAAGCTTAAGCTATTATTACCCTCCGATTGCTTATTCAGACCGCCCAAATCTAGAGGCGGTTTTTTATT
>gi|428262672|gb|CP003646.1|:c1954909-1954836 Gloeocapsa sp. PCC 7428, complete genome-taxID:1173026
TTTAGATTAAGCTGTTAACACCCTCCGATTGCTCAAGCAACCGCCATCAAGCTAGCTAGTGGCGGTTTTTTGTT
>gi|428006994|gb|CP003597.1|:c1592411-1592347 Chroococcidiopsis thermalis PCC 7203, complete genome-taxID:251229
AATCGGTAAGCTGTTGAAAACCCTCCGATTGCTCAACAACCGCCATCTCCTGGCGGTTTTTTATT
>gi|22652017|gb|AF381044.1|:402-473 Synechococcus sp. PCC 7002 type II NADH dehydrogenase B (ndbB) gene, complete cds-taxID:32049
CGCGCTAGGTTAGCAATACCCTCCGATTGCTTATCAAGCTAGACCGTCCTCACCCAGTGGCGGTTTTTTATT
>gi|298231532|gb|CP002059.1|:2779593-2779658 'Nostoc azollae' 0708, complete genome-taxID:551115
AATTAAGTAAGGTGTAATTACCCTCCGATTGCTTAAGCATACCGCCCCCACTAGAGGCGGTTTTTT
>gi|47118302|dbj|BA000019.2|:c4499343-4499277 Nostoc sp. PCC 7120 DNA, complete genome-taxID:103690
CAGAATAGGCTAGAGATTACCCTCCGATTGCTTAACCAGACCGCCCTAATCTAGTGGCGGTTTTTTT
>gi|428249989|gb|CP003630.1|:5983203-5983270 Microcoleus sp. PCC 7113, complete genome-taxID:1173027
GCACCGTAAGCTTGTACTACCCTCCGATTGCTTAATCACGCCGCCCTATTTCTAGAGGCGGTTTTTTA
>gi|427357970|gb|CP003548.1|:5862129-5862200 Nostoc sp. PCC 7107, complete genome-taxID:317936
CGCAGAGTAATCTTTAATTACCCTCCGATTGCTTAACCAGACAACCGCCATCATCTAGTGGCGGTTTTTTAT
>gi|359270229|dbj|AP012276.1|:c1288245-1288176 Synechocystis sp. PCC 6803 substr. GT-I DNA, complete genome-taxID:1080228
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCATTGCTTCAGTGGCGGCTTTCTTTTT
>gi|817925425|gb|CP011382.1|:c4400584-4400516 Calothrix sp. 336/3, complete genome-taxID:1337936
CCCAGAGTAATCTGTAAATACCCTCCGATTGCTTAACCAGACCGCCCTACTTCTCAGTGGCGGTTTTTT
>gi|171696371|gb|CP000806.1|:666566-666637 Cyanothece sp. ATCC 51142 circular chromosome, complete sequence-taxID:43989
AAGACATAAAGTCAATTATCACCCTCCGATTGCTTATTGCAACCGCCCACACTTCAGTGGCGGTTTTTTATT
>gi|428256439|gb|CP003642.1|:c4145252-4145186 Cylindrospermum stagnale PCC 7417, complete genome-taxID:56107
AGCAAAGTAAACTGTAAGTACCCTCCGATTGCTTAACCAAACCGCCCTCATCTTGTGGCGGTTTTTT
>gi|427368660|gb|CP003549.1|:c1417649-1417583 Rivularia sp. PCC 7116, complete genome-taxID:373994
GCAGAGTAACCTATAAATACCCTCCGATTGCTTAACCAGACCGCCCTATTTTAGTGGCGGTTTTTTT
>gi|47118304|dbj|BA000022.2|:c1289326-1289257 Synechocystis sp. PCC 6803 DNA, complete genome-taxID:1148
AAGACATAAAGTCAATATCACCCTCCGATTGCTAGAGGTCGCCCATTGCTTCAGTGGCGGCTTTCTTTTT
>gi|428233323|gb|CP003610.1|:c5163331-5163265 Calothrix sp. PCC 6303, complete genome-taxID:1170562
GTAGACTAAGCTAATCATACCCTCCGATTGCTTAACCAGACCGCCCTTATCTAGAGGCGGTTTTTTT
>gi|75699950|gb|CP000117.1|:4424793-4424859 Anabaena variabilis ATCC 29413, complete genome-taxID:240292
CAGAATAGGCTAGATATTACCCTCCGATTGCTTAACCAGACCGCCCTAATCTAGTGGCGGTTTTTTT
>gi|428245228|gb|CP003620.1|:3331800-3331870 Crinalium epipsammum PCC 9333, complete genome-taxID:1173022
AGCAACGTAAGGTATTGATACCCTCCGATTGCTTAAGACGACCGCCCTCTTTCTAGTGGCGGTTTTTTATT
>gi|306980173|gb|CP002198.1|:c2006173-2006101 Cyanothece sp. PCC 7822, complete genome-taxID:497965
AAGACATAAAGTCAATATCACCCTCCGATTGCTTATCCAAGCCGCCCGTTGTCTAGGGGCGGTTTCTCTTTTT

Taxonomic tree

The taxonomic tree illustrates the outcome of the GLASSgo result.
You can Each taxonomic name has a specific value, which describes the number of summarized GLASSgo hits. These values are also used for scaling the corresponding nodes.

Job resubmission

Use the following button if you want to resubmit the job with altered input or parameterization:
Feeds the job parameters to the input page to resubmit the job.

de.NBI usability assessment

Please support us by filling this short quality survey for evaluating this de.NBI service.
Results are computed with GLASSgo version 1.4.2