Freiburg RNA Tools
GLASSgo - Results
BIF
IFF
GLASSgo 3486856

Input and runtime details for job 3486856 (precomputed example)

Sequence Parameters

? Query sRNA in FASTA[.fa]

Search Parameters

? Taxon selection Proteobacteria
? Parameter setup automatic
? Maximum allowed E-value1
? Minimum allowed identity [%]52
? Structure-based clustering on

Structure-based clustering

? Structure-based filteringauto
? Manual value for filtering2

Job ID 3486856 (server version trunk)

?Job Submitted & Queued@ Mon Oct 02 16:45:21 CEST 2017
?Processing Started@ Mon Oct 02 16:45:36 CEST 2017
?GLASSgo Finished & Post-Processing@ Mon Oct 02 16:50:12 CEST 2017
?Post-Processing Finished@ Mon Oct 02 16:50:22 CEST 2017
?Job Completed@ Mon Oct 02 16:50:24 CEST 2017
 DIRECT ACCESS: http://rna.informatik.uni-freiburg.de:80/RetrieveResults.jsp?jobID=3486856&toolName=GLASSgo ( 30 days expiry )

The job description you specified

EcpR1 in Proteobacteria

? Output download complete results [zip]

In the following FASTA output, the input sequence is given top-most followed by the identified homologs.
If only the input sequence is shown, no homologs could be found.

>EcpR1_Sinorhizobium_meliloti_1021
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|589085422|gb|CP007236.1|:2283540-2283709 Ensifer adhaerens OV14 chromosome 1 sequence-p.c.VAL:74.09%-taxID:1416753
GCGGGGGCATAGCTTCCATCAGCTTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGTTGGCTTTTGACACCTGCGGAATCCTCGTGCCGCGGTCAGTAGCCAGCCGACCCCCATTCAAAGCGCTGTTCCGGAAGGGACAGCGCTT
>gi|334093764|gb|CP002781.1|:1110062-1110228 Sinorhizobium meliloti AK83 chromosome 1, complete sequence-p.c.VAL:100.0%-taxID:693982
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|365177649|emb|HE616890.1|:1104750-1104920 Sinorhizobium fredii HH103 main chromosome, complete sequence-p.c.VAL:80.21%-taxID:1117943
AAAGGAAGTGAGACTTCCACGATCGATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGATTCCGACATCCGCGGATTCCTCGTGCCGCAGTCGGAGCCAGCCGACCCCCTTTCGGAACGCCGCTTCGAAGGAGGCGGCGTTT
>gi|336031356|gb|CP001830.1|:c2256278-2256112 Sinorhizobium meliloti SM11, complete genome-p.c.VAL:100.0%-taxID:707241
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|675826159|gb|CP009144.1|:1399641-1399807 Sinorhizobium meliloti strain RMO17, complete genome-p.c.VAL:100.0%-taxID:382
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|150026743|gb|CP000738.1|:1002522-1002690 Sinorhizobium medicae WSM419, complete genome-p.c.VAL:95.35%-taxID:366394
GCGAGGAAGGAAACTTCCACAGCAATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGATTTGCGGATTCCTCGTGCTGCAACCGGAACCAGCCGACCCCCATTCGAAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|407317441|emb|HE995405.1|:1053842-1054008 Sinorhizobium meliloti Rm41 complete genome-p.c.VAL:100.0%-taxID:1230587
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|227339586|gb|CP001389.1|:1145485-1145656 Sinorhizobium fredii NGR234, complete genome-p.c.VAL:78.31%-taxID:394
TAAGGAAGTGTGACTTCCACGATCGATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGATTCCGACGTCCGCGGATTCCTCGTGCCGCAGTCGGAGCCCAGCCGACCCCCTTTCGGAACGCCGCTCCGAAGGAGGCGGCGTTT
>gi|873266605|gb|CP003933.2|:1383304-1383470 Sinorhizobium meliloti GR4, complete genome-p.c.VAL:100.0%-taxID:1235461
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|30407155|emb|AL591688.1|:1411678-1411844 Sinorhizobium meliloti 1021 complete chromosome-p.c.VAL:100.0%-taxID:266834
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|390125223|gb|CP003563.1|:3505461-3505631 Sinorhizobium fredii USDA 257, complete genome-p.c.VAL:80.65%-taxID:1185652
TAAGGAAGTGTGACTTCCACGATCGATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGTTTCTGACATCCGCGGATTCCTCGTGCCGCAGTCGGAGCCAGCCGACCCCCTTTCAAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|459645537|gb|CP004140.1|:1411680-1411846 Sinorhizobium meliloti 2011, complete genome-p.c.VAL:100.0%-taxID:1286640
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT
>gi|333810283|gb|CP002740.1|:974429-974595 Sinorhizobium meliloti BL225C, complete genome-p.c.VAL:100.0%-taxID:698936
GCGAGGAAGGAAACTTCCACAGCATTCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCCTCGGACTTGCGGATTCCTCGTGCTGCAACCGGACCAGTCGACCCCCATTCGAAACGCCGCTTCGAAAGAGGCGGCGTTT

Taxonomic tree

The taxonomic tree illustrates the outcome of the GLASSgo result.
You can Each taxonomic name has a specific value, which describes the number of summarized GLASSgo hits. These values are also used for scaling the corresponding nodes.

Job resubmission

Use the following button if you want to resubmit the job with altered input or parameterization:
Feeds the job parameters to the input page to resubmit the job.

de.NBI usability assessment

Please support us by filling this short quality survey for evaluating this de.NBI service.

When using GLASSgo please cite :

Results are computed with GLASSgo version 1.5.0