mRNA Sequence with Structure and its Probability for the SECIS-Element region after UGA stop codon

Wanted Structure: 
[,[[[[[{[[/((.((((....))))))\]]}]]]]]]....

NNNNNNNNNNNSSUWSCAGGUCUGSWSSNNNNNNNNNNNNNN
 Prob.:
mRNA-Sequence without optimizing the stability of the structure: 
AUUUUCUCUUCGCUACCAGGUCUGGUGCCAAAAGGAAAAGAA
..(((((.((.((.((((....)))))).)).))))).....
.((((((.((.((.((((....)))))).)).))))))....
(0.04)
(0.19)
mRNA-Sequence after optimizing the stability of the structure: 
AAGUUCUCUUCGCUAGCAGGUCUGCUGCCAAAAGGACAAGAA
..(((((.((.((.((((....)))))).)).))))).....

(0.58)


Amino Acid Sequence after selenocystein insertion position

Original Sequence
(starting at pos. 96): 
 I F S S S L K F V P K G K E
Without optimizing the stability of the mRNA-structure: 
 
 I F S S L P G L V P K G K E
After optimizing the stability of the mRNA-structure: 
 K F S S L A G L L P K G Q E