Wanted Structure: | [,[[[[[{[[/((.((((....))))))\]]}]]]]]].... NNNNNNNNNNNSSUWSCAGGUCUGSWSSNNNNNNNNNNNNNN | Prob.: |
mRNA-Sequence without optimizing the stability of the structure: | AUUUUCUCUUCGCUACCAGGUCUGGUGCCAAAAGGAAAAGAA ..(((((.((.((.((((....)))))).)).)))))..... | (0.04) (0.19) |
mRNA-Sequence after optimizing the stability of the structure: | AAGUUCUCUUCGCUAGCAGGUCUGCUGCCAAAAGGACAAGAA | (0.58) |
Original Sequence (starting at pos. 96): | I F S S S L K F V P K G K E |
Without optimizing the stability of the mRNA-structure: | I F S S L P G L V P K G K E |
After optimizing the stability of the mRNA-structure: | K F S S L A G L L P K G Q E |